Answer:
Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA) sequence into a protein. tRNAs function at specific sites in the ribosome during translation, which is a process that synthesizes a protein from an mRNA molecule.
Thank you and please rate me as brainliest as it will help me to level up
Answer:In summary, the scientific method includes the steps scientists use to solve a problem or to prove or disprove a theory. There are four basic steps involved with the scientific method. The usual steps include observation, hypothesis, experiment, and conclusion. The steps may not always be completed in the same order.
Explanation:
The type of immune cells that makes a large amount of a specific antibody is known as plasma cells. These cells are basically differentiated terminally from the B-type of lymphocytes. Many organelles are present in these cells performing the functions they are assigned with or they are made for such as; Ribosomes, Mitochondria, Lysosomes, Endoplasmic Reticulum, Golgi apparatus, and the plasma membrane. The most abundantly found organelle in the plasma cells is Rough Endoplasmic Reticulum combined with the well-developed Golgi apparatus.
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
Answer:
The organism that can live deep beneath the earth surface despite intense pressure heat lack of water and sunlight might be Nematodes.
Explanation:
- Nematodes are able to cope extreme heat or extreme cold and dehydration. They have adopted by learning technique that allows them to survive. They can transform into a hardy form called the dauer stage.
- They can survive harsh conditions for longer durations at this stage. And again awaken themselves when conditions are favourable again.
- They can be found in hot springs, deserts, high up mountains and in the deepest oceans.