1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
3 years ago
7

Kenny has been diagnosed with parkinson disease and has been prescribed medication to manage some of his symptoms. the medicatio

n elevates the levels of dopamine in his system. if the levels of dopamine in his system become excessive, kenny might start to exhibit symptoms associated with
Biology
1 answer:
Sliva [168]3 years ago
8 0
If the levels of dopamine in his system become excessive, Kenny who has been diagnose with Parkinson disease and has been prescribed medication to manage some of his symptoms might start to exhibit symptoms associated with schizophrenia. Schizophrenia is a severe mental disorder that affect the people in how they behave, thinks and feels.
You might be interested in
The following questions refers to the paragraph above.
brilliants [131]

Answer:

1- What are the genotypes of the father and the mother?

Answer: A. FF FF

2-What is the chance of the next child of this couple having straight little fingers?

Answer: B. 25%

Hope this help

I’m sorry if its wrong

Enjoy your day ;)

7 0
3 years ago
Read 2 more answers
What is a dramatic environmental event?
Vsevolod [243]

An example of an dramatic environmental event can be deforestation, or it can be animals losing their homes.

4 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Give me a short definition of data interpretation.<br><br> Please, a short one.
ikadub [295]
Part of us humans daily life.
6 0
2 years ago
Which following is dead structure in cell ​
steposvetlana [31]

Answer:cell wall

Explanation:The cell wall in plant cell is made of cellulose and functions to provide rigidity to the cell. Cell wall has no living function

5 0
2 years ago
Other questions:
  • Jupiter is 317 times more massive than the Earth. Its gravitational attraction is _____ Earth's.
    11·2 answers
  • What is DNA's job within the body?
    7·1 answer
  • Varicose veins seen in the superficial veins of the legs are unsightly and are often treated by surgical removal. However, even
    10·1 answer
  • What’s associated with rock systems in biology geologic time scale
    6·1 answer
  • Identify and discuss factors that influence ecosystem productivity.
    9·2 answers
  • An astronomer see a star that is very far away but still very bright. What can she conclude about the star?
    14·2 answers
  • What is the difference between extrinsic and intrinsic clotting?
    10·1 answer
  • PLEASE HELP QUICK!!!!!!! WILL GIVE BRAINIEST!!!!!!!!
    6·1 answer
  • PLEASE HELP!!!!!!!!!
    12·1 answer
  • A hurricane forms over the warm waters of the Atlantic Ocean. Mr. Gaines class determined that the pressure in the center of the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!