1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivahew [28]
4 years ago
8

Oxidising agents *

Biology
1 answer:
NNADVOKAT [17]4 years ago
8 0

Answer:

Option A. are mostly non-metals.

Explanation:

Oxidising agents are mostly non-metals because non metals gains electron from the metal during chemical bond and we know that oxidising agent is electron accepter not donar. For example, Sodium is a metal react with chlorine which is a non-metal so the sodium losses electron and this electron is gain by chlorine atom forming sodium chloride. In this example chlorine is a non-metal which gains electron.

You might be interested in
Hi! please help i’ll give brainliest
Neko [114]

Answer:

An Ocean Shore

Explanation:

The wind would erode and deposit sand from dunes, and the water from the waves will erode rocks.

3 0
3 years ago
Read 2 more answers
In transcription, _____ is used as a template for the construction of a new rna molecule.
monitta
I think the answer should be B. is the correct answer.  In transcription, a segment of one strand of double stranded DNA.

Hope it helped!
8 0
4 years ago
Please explain what happens when a muscle cramps.
elixir [45]

Answer: "A muscle cramp is a sudden and involuntary contraction of one or more of your muscles"

Explanation:

3 0
3 years ago
Read 2 more answers
What should the student say to the astronaut to explain the shape of the planets' orbits around the Sun? In your answer, discuss
Rudik [331]

The shape of the planets' orbits around the Sun in this scenario can be referred to as an elliptical shape.

<h3>What is an Elliptical shape?</h3>

This is similar to the shape of an ellipse in which the elongated circle stretches into an oval.

The shape of the orbits of the planets are all nearly circular as a result of the distance of the planets from the sun being millions of miles apart.

Read more about Elliptical shape here brainly.com/question/2459563

4 0
3 years ago
List the order the steps of the path of blood through the kidneys.
Alexxandr [17]

Blood flows to the kidneys through the right and left renal arteries. Inside each kidney these branch into smaller arterioles.

The blood is at very high pressure and flows through the arterioles into tiny knot of vessels called the Glomerulus. These are located in the nephrons.

From the glomerulus the blood pressure drops and the blood flows into arterioles which coil around the nephrons. These in turn connect to a series of small veins. These vessels reunite and ultimately form the renal vein.

About one quarter of the total cardiac output (or total blood flow) circulates through the kidneys. This equates to just over 1 litre of blood every minute.

Hope this helps (:

5 0
4 years ago
Other questions:
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • In the chemical compound C2H2, how many pairs of electrons are shared between the two carbon atoms?
    10·2 answers
  • What happens during evaporation? water falls from the atmosphere to the ground water vapor changes into a liquid and forms cloud
    14·1 answer
  • The endocrine gland that is probably malfunctioning if a person has a high metabolic rate is the parathyroid.
    7·1 answer
  • Wich occurs before the cell enters the g,2 stage of the cell cycle
    15·1 answer
  • 4.
    10·2 answers
  • When an organism is exposed to a limited quantity of oxygen, the cell's mitochondria will stop cellular respiration involving th
    6·2 answers
  • How does sedimentary rock usually form?
    14·1 answer
  • beautiful clownfish named Bozo, a common salt water fish. Zara already has a tank with goldfish at home. Use your knowledge of d
    13·1 answer
  • What is one cause of long-lasting climate change?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!