1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GenaCL600 [577]
3 years ago
7

Help please i’m stuck due soon!

Biology
1 answer:
Tcecarenko [31]3 years ago
3 0
The answer to your question is B. DNA
You might be interested in
help please!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!What is the dew point? A. The time of day when gas condenses. B. The density at whi
Klio2033 [76]

your answer is C. it is temp where water vapours start to condense and forms liquid droplet from vapour condition.

hope it helps. please mark for best answer if you liked it.

4 0
3 years ago
Read 2 more answers
4. what two main things happen during Prophase of Mitosis? Why is each necessary for the cell to divide? What
Anni [7]

Answer:

The two main things happen during Prophase of Mitosis are given below.

1) In prophase stage of mitosis, condensation of chromosomes occurs which is necessary for the formation of daughter cells.

2) Breakdown of nuclei occurs and moves to the opposite poles.

If this phase is not take place during mitosis, the cell will not divide into daughter cells

3 0
3 years ago
Musicians must train their muscles to play instruments, just as athletes must train their muscles to play sports. true or false?
katen-ka-za [31]
I think it is true because musicians do have to know their instrments and they have to know how to play it how to read the music or if you sing there is a lot more to it. and with athletes they have to have good strength and they have to understand whatever sport they play.
8 0
3 years ago
Read 2 more answers
as compared with the production of egg cells, sperm cell production A) involves a jellylike outer covering b) occurs at a slower
Bingel [31]

The correct answer is:  d) begins later in life

Eggs or female reproductive cells are formed well before birth in a huge number (primordial oocytes). But, the number of oocyte decreases after birth constantly (there are 2 million oocytes at birth and 40,000 of them in puberty). At menopause, no egg cells are left.

On the other hand, the first sperms are formed only from puberty, but the production of those cells never stops.

4 0
3 years ago
Compare and contrast inexhaustible and renewable resources. Plz help I’m despreat
pickupchik [31]

Answer:

Compare and contrast inexhaustible and renewable resources. Inexhaustible resources are sources of energy that will never run out. In contrast, renewable resources could potentially run out. They are finite energy resources that can be replaced in a relatively short period of time.

Explanation:

6 0
3 years ago
Other questions:
  • *Hedgehogs are nocturnal and hibernate during the winter. Which of the
    6·1 answer
  • 7. ) Most of a cell's growth and activity occurs in the ______ phase.
    12·1 answer
  • Are all these secondary consumers ?
    5·1 answer
  • Legumes host nitrogen fixing bacteria, and
    11·1 answer
  • How is Carbon Dioxide abbreviated (shortened)?
    14·1 answer
  • After Translation, a polypeptide chain undergoes modifications. Which of the following would NOT
    7·1 answer
  • How did the discovery of new elements such as gallium demonstrates the usefulness of mendeleev's table?
    9·1 answer
  • Biological twins look alike because of what ​
    6·1 answer
  • True or false: autosomes are sex chromosomes
    13·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!