I believe it’s a Mercator map/projection.
Answer:
C. A single individual would have to gain control from an elite few.
Explanation:
In order to change an oligarchy into an autocracy, a single individual would have to gain control from an elite few. Autocracy refers to a system of government in which one person with absolute power rule over the whole country. In autocracy, a high rank military general have absolute power because the whole military is present under it and he can maintain its control over th country with the use of military forces.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
1. We know the earth is getting warmer because temperatures have risen all around the globe. Also, the Arctic is melting.
2. The Earth temperature changes because of green house gases and harmful gases being sent into the atmosphere.
3. The greenhouse effect is a process that occurs when gases in Earth’s atmosphere trap the Sun’s heat.
4. Factories.
5. It could cause more flooding and a rise of warmer temperatures.
6. Permafrost is ground that continuously below 0 degrees Celsius for two or more years.
Hope this helps!
