1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
3 years ago
6

The _____ theory is an evolutionary concept that suggests that behaviors that help an organism survive are passed on while weak

behaviors are lost.
Biology
2 answers:
Sergeeva-Olga [200]3 years ago
6 0
The answer is the genetic drift theory, hope I could help :)
nika2105 [10]3 years ago
5 0
In population genetics, Gene Flow<span> (also known as </span>gene<span> migration) is the transfer of alleles or </span>genes<span> from one population to another. Migration into or out of a population may be responsible for a marked change in allele frequencies (the proportion of members carrying a particular variant of a </span>gene<span>).

Its genetic flow hope it helped</span>
You might be interested in
The phanerozoic eon is divided into three eras. What are they
Aleonysh [2.5K]
1- Paleozoic era
2- mesozoic era
3- Cenozoic era
3 0
3 years ago
What type of rock is this?
lilavasa [31]

It's Sedimentary and the name of the rock is Conglomerate

8 0
3 years ago
Read 2 more answers
7. The escape of gas and rapid cooling leave holes in
vekshin1

Answer:

intrusive i think

Explanation:

7 0
2 years ago
HELP 20 points!!! Due now
charle [14.2K]

Answer:

C

Explanation:

They turn into fossils! Please crown brainliest!

7 0
3 years ago
Read 2 more answers
Biceps are made mostly of _____. neurons, squamous epithelial, cells, skeletal muscle, smooth muscle
Inga [223]
The biceps brachi (biceps) is a skeletal muscle

7 0
3 years ago
Read 2 more answers
Other questions:
  • Lactose is milk sugar, and as infants, humans produce substantial amounts of the lactase enzyme to digest it. However, as we age
    15·1 answer
  • Describe the number of chromosomes in sex cells
    15·1 answer
  • When humans touch something nerve impulses travel to and from the brain at a rate up to?
    13·1 answer
  • The sea breeze effect happens because:
    12·1 answer
  • Enzymes contain a(n) ____________ that is formed to fit a specific type of ____________ . Once the ____________ binds to the enz
    6·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • Which of these diagrams is a convex mirror?<br><br><br> A is the answer
    6·2 answers
  • This is the question ​
    5·1 answer
  • Why does a diagram look more like a bush than a straight line
    5·1 answer
  • What is the main purpose of the extracellular matrix surrounding osteocytes?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!