1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr [31]
3 years ago
10

Difference between jellyfish and Starfish​

Biology
2 answers:
TiliK225 [7]3 years ago
5 0
They both breath cause they also need oxygen
jenyasd209 [6]3 years ago
4 0

Answer

Starfish also have a small eye spot in the middle of their bodies that allow them to differentiate between light and dark. Jellyfish are classified as Cnidarians because they have tentacles that sting. ... While Starfish are solid creatures, the jellyfish is very slight. It is 95 percent water.

Explanation:

You might be interested in
Tại sao chúng ta lại bị trụt rút
cestrela7 [59]

Khi bạn quỳ lâu, đứng lâu sẽ gây ép lên các cơ bắp và mạch máu. Hoặc một tình trạng khác là khi ngủ bạn thường xuyên để cong chân, cơ bắp ở bắp chân khá ngắn, không được duỗi ra, duy trì tư thế này lâu, khi cử động nhẹ bạn sẽ bị chuột rút.

3 0
2 years ago
What happens as humans use more land for development<br>​
Lina20 [59]

Answer:

Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

4 0
3 years ago
Read 2 more answers
The prediction of the evolutionary model expects an increase in variety of new organisms. true false
adell [148]
False because many different species are going extinct within our lifetime
8 0
3 years ago
Read 2 more answers
Glycogen is _____. a polysaccharide found in plant cell walls a polysaccharide found in animals the form in which plants store s
sesenic [268]

Answer:

The correct answer is-a polysaccharide found in animals

Explanation:

Glycogen is a polysaccharide which is a highly branded form of amylopectin. In glycogen glucose residues are joined together by α1-4 glycosidic linkage and α 1-6 branching points occurs after every 8-10 glucose residues.

Glycogen is the main carbohydrate storage form of carbohydrates in animals. Glycogen is mostly present in liver and muscles. It breaks down into glucose and provide energy to the animal during the physical activity. Therefore glycogen is polysaccharide found in animals.

7 0
3 years ago
А _______<br> serves as a long-term storage area for water or nutrients.
-Dominant- [34]
Reservoir . This is the correct answer trust me .
7 0
3 years ago
Read 2 more answers
Other questions:
  • During cell division, or mitosis, an exact duplicate of the original cell is produced. The instructions for cell division are fo
    9·2 answers
  • A blood pressure of 60 over 80 would indicate that a patient had…
    15·2 answers
  • What technique is used by all three branches of science to make discoveries
    13·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • which of the following statements about scientific theories are true? (A) theories cannot be tested (B) theories are the same as
    7·1 answer
  • What is found in chloroplasts of green algae? chlorophyll fungi diatoms ribosomes
    8·2 answers
  • Why is a duck billed platypus unusual to other mammals
    8·1 answer
  • How did Pasteur’s experiment with tech flasks help disprove the idea that living things could just appear or come from non livin
    11·1 answer
  • What do u mean by photosynthesis​
    7·2 answers
  • which pathway allows for the breakdown of carbohydrates by splitting glucose molecules to form pyruvate?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!