1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
4 years ago
11

Nicholas has been biting his nails since he was a kid. He wants to break the habit so he puts bitter-tasting nail polish on his

left hand and leaves his right hand without polish. After 3 days he notices his nails on his left hand have grown but he continued to bite his right-hand nails.
A. Independent Variable=
B. Dependent Variable=
C. Control=
Biology
2 answers:
Aleksandr-060686 [28]4 years ago
6 0

Answer:

Independent: Putting the nail polish

Dependent: nail growth

Control: right hand, without polish

9966 [12]4 years ago
5 0

Answer:

C

Explanation:

You might be interested in
What does alternative energy mean?
allochka39001 [22]

Answer:

B

Explanation:

Alternative energy is the same thing as renewable energy which should be natural processes

3 0
3 years ago
Read 2 more answers
What is science??????????????????/
elena-14-01-66 [18.8K]

Science is the study and learning mechanism of the world and how everything is created as well as used today and billion of years ago

5 0
3 years ago
Read 2 more answers
A(n) <br> is a group of cells that work together to perform a common function.
Yuliya22 [10]

Answer:

tissue

Explanation:

a tissue is a group of cells that work together to perform a common function

5 0
2 years ago
Read 2 more answers
Plants use oxygen in respiration.<br> True<br> Or<br> False
MA_775_DIABLO [31]

Answer:

True

Explanation:

very true

4 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • How do chemicles cycle and energy flow?
    8·1 answer
  • What is the importance DNA in the human body
    10·1 answer
  • A child is seen in a hospital-based pediatric clinic for active treatment 10% of first and second degree burns to the calf area
    8·1 answer
  • One reason farmers might choose non-GM crops over GM crops is because non-GM crops are A. less safe. B. more productive. C. less
    5·2 answers
  • Why are the interactions and tissues in the menstural cycle considered to be feedback mechanisms
    5·1 answer
  • The distance from Earth to the Sun is 1.0 _____.
    14·2 answers
  • What does it mean to say that the U.S. Government has a balanced budget?
    13·1 answer
  • How is morphology different from embryology? How is it similar?
    12·1 answer
  • A fold is a ------------ in rock, and a fault is a -------------- in rock.
    6·2 answers
  • What adaptations of large herbivores allow them to live in the taiga? (Select all that apply.)
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!