1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BartSMP [9]
4 years ago
11

Question 4 (5 points)

Biology
1 answer:
Monica [59]4 years ago
7 0

Answer:

The answer is Small intestine

Hope this helps

You might be interested in
How does a lever make work easier
mel-nik [20]
~The images below will hopefully help. :)
*The pulley is a lever, and it helps lifts things higher with less force then trying to normally pick it up.

3 0
3 years ago
Read 2 more answers
What is a fossil?
Scilla [17]
A fossil is the remains of an ancient organism.
7 0
4 years ago
Read 2 more answers
Which statement about photosynthesis and cellular respiration is true
guajiro [1.7K]

Answer:

d

Explanation:

8 0
3 years ago
Please find the correct answer
harina [27]

Answer:

the second one

Explanation:

3 0
3 years ago
Read 2 more answers
How do i find the genus and species of a living or extinct organism?
enot [183]
The genus and species of a living or an extinct organism is the category that an organism is classified in. This also gives organisms specific names used for binomial nomenclature.
7 0
4 years ago
Other questions:
  • Patients who have experienced even minor-appearing head injuries should be suspected of having a brain injury, especially if the
    15·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • What is the relationship among phylum,class and order?
    5·2 answers
  • When a high carbohydrate meal is eaten, blood sugar levels ____________, which stimulates the release of _____________, which th
    13·1 answer
  • Which describes a Characteristic of branched polymers
    6·1 answer
  • What direction will the particles move?
    14·1 answer
  • What happens during translation?
    12·2 answers
  • DNA replication is a process that involves copying the DNA molecule if a single base was miscopied what would be a possible resu
    8·2 answers
  • Name one unique characteristic of the tobacco mosaic virus.
    14·2 answers
  • What is the use of melatonin in body​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!