1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
9

How does a rhinovirus cause symptoms of a common cold to spread in the

Biology
2 answers:
slavikrds [6]3 years ago
7 0

Answer:

I think it should Be C).The new virus kills...etc

Bad White [126]3 years ago
7 0
C. The new viruses formed inside one cell infect and quickly kill other
cells.
O
You might be interested in
What two natural resources will be most affected as people try to meet the growing demand for food
Alexxx [7]
Crops and fuel

I hope I've helped!
4 0
3 years ago
Pollination of a flower or plant with pollen from a different flower or plant is known as​
elixir [45]

Answer:

Cross-pollination

Explanation:

cross-pollination is when pollen from one plant gets transported to another plant.

self-pollination is when pollen gets transported from the anther to the stigma of the same flower or a different flower on the same plant.

5 0
3 years ago
Which explains how the economic situation in chile in 1980 affected its government? chile’s improving economy led to the governm
liq [111]

The economic situation best describe by Chile’s worsening economy led to the government being overthrown by a military junta.

<h3>What is the economic history of Chile?</h3>

The economic condition of Chile changed over time.

Due to a worldwide recession, the GDP of Chile dropped to 14.1 in 1980.

The value of the currency is overvalued.

Due to the Asian crisis, in 1997 economic growth depletion started.

Thus, the correct option is C.

Learn more about  Chile

brainly.com/question/14215140

5 0
2 years ago
Which nutrient contains nitrogen in its chemical composition?
guapka [62]

Answer:

Protein

Explanation:

It has nitrogen, hydrogen, oxygen, carbon, and sometimes small amount of sulfur

6 0
3 years ago
Explain how the invention of the motor vehicle has been both beneficial and harmful?
natulia [17]
It is harmful because motor vehicles spit out gas and like fumes. That can lead to pollution in the air.

It is beneficial because it helps people get to places they need to get to quicker
8 0
4 years ago
Other questions:
  • What does DNA control ?
    6·1 answer
  • PLEASE HELP!!!!
    8·2 answers
  • Polyethylene is a polymer made from ethane molecules that have been joined together what is ethane in this polymer
    14·2 answers
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which graph BEST shows the relationship of kinetic energy (solid line) to potential energy (dotted line) as a hawk dives downwar
    8·2 answers
  • How do flowers help with plant reproduction
    9·1 answer
  • Which organelle captures sunlight and helps in food synthesis??
    7·2 answers
  • What are the major parts of an ecosystem​
    15·1 answer
  • PLEASE HELP DUE SOON
    5·1 answer
  • Hellpppp plz SOS helllppppp
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!