1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
7

What are the tough and flexible connective tissues seen in embryos?

Biology
1 answer:
Vikentia [17]3 years ago
5 0
I think it would be cartilage. However, I’m unsure.
You might be interested in
How many kilometers north of the equator is washington, D.C.
liberstina [14]
The answer to the problem is 2,677 mi
7 0
3 years ago
Read 2 more answers
3. All of the organic molecules are based on which element?
Ulleksa [173]

Answer:

<h2><u>Carbon</u><u>.</u><u> </u></h2>

Explanation:

<em>Life is based on carbon; organic chemistry studies compounds in which carbon is a central element. The properties of carbon make it the backbone of the organic molecules which form living matter. Carbon is a such a versatile element because it can form four covalent bonds.</em>

<h3><em><u>Hope</u></em><em><u> </u></em><em><u>it</u></em><em><u> </u></em><em><u>helps</u></em><em><u> </u></em><em><u>you</u></em><em><u>⚛</u></em><em><u>.</u></em></h3>

<em><u>Thanks</u></em><em><u>☸</u></em><em><u>.</u></em>

7 0
3 years ago
Can yeast replace itself with new cells
ollegr [7]

Answer: Yes

Explanation:Most yeasts reproduce asexually by budding: a small bump protrudes. A few yeasts reproduce by fission, the parent cell dividing into two equal cells.

6 0
3 years ago
____ is the theory that living organisms are composed of organic compounds that contain a vital force that is not present in non
Ksju [112]

Answer:

The answer is between a or b

but I strongly suggest the option a.

Evolution is the answer

3 0
3 years ago
When information has to cross our corpus callosum, we respond _____ when the information does not cross the corpus callosum?
adell [148]

When information has to cross our corpus callosum, we respond slower than when the information does not cross the corpus callosum.

Corpus callosum is a bundle of nerve fibers that connects the left and right cerebral hemispheres and enables them to communicate. It has been shown that corpus callosum can have both, an inhibitory and excitatory influence on the contralateral hemisphere.


7 0
3 years ago
Other questions:
  • Why do the stars appear to be moving across the sky
    6·2 answers
  • Land and surface water absorb solar energy, then emit _____, which fuels evaporation. Increased evaporation causes air near the
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the waste product of photosynthesis?
    15·1 answer
  • Describe the ways in which a polymer is affected by condensation (or dehydration) and hydrolysis reactions. Explain why phosphol
    13·1 answer
  • There are two types of cell division. The first (A) produces cell that are identical to the original cell. The second (B) produc
    15·1 answer
  • Answer 24-25 please, please do not comment nonsense if not you will be reported. The first accurate and correct answer gets brai
    10·1 answer
  • Hi! My name is Sadie I'm 14, (15 tomorrow X3) Uh this isn't really about school.. But i'm highly concerned.. As you know I'm 14,
    7·2 answers
  • Which of the following statements is true?
    12·2 answers
  • Rade Repair 1st Semester-Hughes
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!