1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lianna [129]
3 years ago
11

Buy-O-Mart sells magazines at a 10% discount. What amount will you pay the cashier for a magazine that costs $5.99 and has a sal

es tax of 4%?
Mathematics
1 answer:
Ede4ka [16]3 years ago
4 0
Here's the equation:
0.90(5.99) + 0.04(0.9(5.99))
We can simplify this:
0.90(5.99) + 0.036(5.99)
5.391 + 0.21564
5.60664
We can round:
It will cost about $5.61
You might be interested in
PLEASE HELP ASAP!!! CORRECT ANSWER ONLY PLEASE!!!
PIT_PIT [208]

The correct answer is C: Families in the neighborhood that do not use the pool.  

8 0
4 years ago
Read 2 more answers
Statistics should not be used as a blind man does a lamp-post instead of illumination.
noname [10]

Answer:

Not quite sure what you are aiming for in this question; however, I guess that is true? A blind man wouldn´t simply rely on a lamp-post to get around.  I guess what is being said is that statistics should be used when it is useful? There are plenty of ways people can analyze that statement.

Step-by-step explanation:

5 0
3 years ago
Which one doesn’t belong?identify the phrase that cannot be described by the same absolute value as the other three?
lys-0071 [83]

Answer:

8 miles above sea level.

Step-by-step explanation:

A loss of 8 pounds

= -8 pounds

8 miles from sea level

= Talking about distance.

18° below normal

= -8 degrees

Giving away $8

= -8 dollars

4 0
4 years ago
Help please. I'll give the Brainliest.
sdas [7]

Answer:

Options 1,2,3 are correct statements

The first values in an ordered pair ( the coordinates) are the domain : ( -3,-2,-1,0,1)

The second values are the range : (-1,1,2,3,4,5)

One input should have only one output for a function.

But -1 input has 2 outputs: -1 and 3.

Thus, it is a relation and not a function.

Hope it helps :)

Mark it Brainliest pls:)

8 0
3 years ago
Read 2 more answers
Please help me out with this
Anettt [7]

Answer:

81.75 ft²

Step-by-step explanation:

The area (A) of a trapezoid is calculated using the formula

A = \frac{1}{2} h (a + b)

where a, b are the parallel bases and h is the perpendicular height

Calculate h using the right triangle and the sine ratio

sin30° = \frac{opposite }{hypotenuse} = \frac{h}{10}

Multiply both sides by 10

10 × sin30° = h, thus

h = 5

a = 12 and b = 8.7 + 12 = 20.7, hence

A = \frac{1}{2} × 5 × (12 + 20.7)

   = 0.5 × 5 ×32.7

   = 81.75 ft²

7 0
3 years ago
Other questions:
  • Last month Leonhard Euler's Watch kiosk at the mall had total sales of $9,489. Merchandise totaling $225 was returned. The goods
    14·1 answer
  • WILL GIVE A BRAINLIEST!! PLEASE HELP!!
    11·2 answers
  • Two fair dice each have 5 sides numbered 1-5. Let X be the sum of the two dice. Determine (a, 10%) the probability distribution
    10·1 answer
  • Item 19 Question 1 A nurse is making identical first aid bags for patients using 72 antiseptic wipes, 55 adhesive bandages, and
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Humihingi po ako sa inyo ng tulong po, sana matulungan nyo po ako dito☝​
    7·1 answer
  • ​Al’s Produce Stand sells 6 tomatoes for $0.90. Barbara’s Produce stand sells 11 tomatoes for $1.54. Which produce stand has the
    15·1 answer
  • The smallest composite number that can be written as a product of 4 different prime number are
    10·2 answers
  • Identify the leading coefficient in the following polynomial:<br> 10x2 + 3x – 5
    13·1 answer
  • The two rectangular prisms are similar. What is the volume of the larger rectangular prism? 240 cm³ 540 cm³ 1620 cm³ 3240 cm³ A
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!