Answer:
A. National Forests
Explanation:
Mulitple use lands are lands where there are more than one use for it. The idea behind multiple use lands is that the benefit is equal for everyone including tourists and producers. National forests fits this description well.
Parasites will grab on the the host to generate more parasites, and when the cell bursts, the parasites will shoot out in every direction to grab more prey.
Some environmental factors are how many deer there are in that park. If there is not a lot of deer, then the deer bag limit shouldn't go up, otherwise, there would be no more.
Answer:
Option A, Key stone
Explanation:
A keystone species plays a major role in an ecosystem as it is the species whose presence effects all other species in the ecosystem .In general a keystone species is always a dominant predator that feed on prey population. If it is removed, the prey population will explode and the population diversity will reduce. For example - bison, prairie dog etc.
Hence, option A is correct
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
