Answer:Conservation biologists, philosophers, environmental ethicists, and others offer several key reasons to conserve biodiversity. One argument is that organisms have direct economic value for humans. We use plants and animals for medicines, food, clothes, building materials, recreation, and other luxuries and necessities. But what if an organism that is of no use to us for food or hides is screened for useful medicinal compounds and found to have none? Do we sanction its extermination? Why must a plant or animal be of direct economic benefit to humans to have worth? Economic value alone is not the only reason to preserve biodiversity.
Another reason often given…to conserve biodiversity is that organisms, as components of ecosystems, provide services, and their interactions with other organisms contribute to the overall healthy functioning of ecosystems… On a practical level, biologists want to know just how much the loss of a few species will reduce the quality of services within a specific ecosystem. Two schools of thought prevail.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
Answer: The main function of NADH is the formation of energy in the form of Adenine tri phosphate (ATP).
Explanation:
In ATP production, the transfer of electron occurs by the NADH molecule. It also necessary for the reaction that occurs in the storage of energy molecules. NADH stands for nicotinamide adenine dinucleotide hydrogen. It produces energy through oxidation reduction reaction.
"it is needed to ensure that equal 3-carbon units can be made."
One important part of the glycolysis is the metabolization of two three-carbon molecules. A glucose molecule could not be divided into two molecules. <span>
After a phosphorylation of the fructose, the molecule has now two phosphate groups. The molecule is then divided into two and the glyceraldehyde-3-phosphate (one of two) continues the chain reactions of glycolysis.</span>
All cells are surrounded by a plasma membrane made of two layers of phospholipids and integrated membrane proteins.
Hope this helps!
pls give Brainliest answer!
