1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julsineya [31]
3 years ago
13

What is the Bermuda Triangle

Geography
2 answers:
Radda [10]3 years ago
5 0
Area in the western part of the North Atlantic ocean. Lots of air crafts and ships have <span>disappeared </span>there. Which is very creepy.
Arlecino [84]3 years ago
4 0

<span>The Bermuda Triangle, also known as the Devil's Triangle, is a loosely-defined region in the western part of the North Atlantic Ocean, where a number of aircraft and ships are said to have disappeared under mysterious circumstances</span>
You might be interested in
The contrapositive of the statement “If you believe in yourself, then you will go far in life” is “If you do not go far in life,
iren2701 [21]
This would be true.
5 0
2 years ago
Read 2 more answers
When the Congo River reaches Kinshasa, _____.
Burka [1]
If my memory serves me well, the answer should be: When the Congo River reaches Kinshasa, <span>it flows slowly into the Atlantic. Congo River is the second largest lake in the world. It takes a long way to reach the Atlantic: In the middle it flows towards Matadi and divides into several arms and finally it freely flows into the Atlantic.</span>
5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Which of the following situations is the best example of involuntary migration?
Semenov [28]

Answer:

Choosing to move in order to work at a better job.

Explanation:

6 0
3 years ago
Read 2 more answers
Multiple Choice
Vlad [161]
Uneven; poor by u.s standards
5 0
2 years ago
Other questions:
  • What describe absolute location using latitude and longitude
    12·1 answer
  • The majority of Americans who are members of an organized religion are __________. A. Jewish B. Muslims C. Protestants D. Roman
    8·2 answers
  • What is a partial solar eclipse definition?
    10·1 answer
  • If an animal leaves a footprint in soft mud, what type of fossil may be made?
    12·1 answer
  • Jihad vs. McWorld depicts a. The integrative and polarizing tendencies of globalization b. The golden straitjacket of globalizat
    8·1 answer
  • What does “Global Attention <br> Level” refer to?
    11·1 answer
  • When life first evolved, ocean temperatures were ________ and there was ________ atmospheric oxygen.
    5·1 answer
  • Why tidal power is called a flow<br> resource, not a renewable resource.
    13·2 answers
  • What happens when a low air pressure system meets a high air pressure system?.
    15·1 answer
  • Early scientific attempts at determining Earth's age gave a number that was ______. Multiple choice question.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!