1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
e-lub [12.9K]
3 years ago
7

When blood glucose levels are high:

Biology
1 answer:
notka56 [123]3 years ago
5 0
I believe the answer is C
You might be interested in
There are three checkpoints in the cell cycle what is the role.
Tanzania [10]

The 3 checkpoints include G1 where the cell growth is checked, G2 where the integrity of the DNA/chromosome is checked, and M where the integrity of the metaphase plate is checked.

<h3>Cell cycle checkpoints</h3>

There are 3 regulatory checkpoints in the life cycle of cells:

  • G1: the size of the cell, the presence of growth factors, and the integrity of the DNA are checked before the cell irreversibly commits to division.
  • G2: the integrity of the DNA and the correctness of the replication process at the S-phase are checked.
  • M: correct attachment of the spindle fibers to the chromosomes at the metaphase plate is checked.

More on cell cycle checkpoints can be found here: brainly.com/question/2128300

6 0
2 years ago
Help me with this and I shall mark you the brainiest!!
Marysya12 [62]

Answer:

Mitosis and meiosis both involve duplication of a cell's dna content

4 0
2 years ago
Identify a signal the brain sends out after the nervous system sends the signal that pH has dropped.
spin [16.1K]

In response to a notification of a <u>decrease</u> in blood pH by the nervous system, the brain sends signals to the external intercostal muscles and the diaphragm.

<h3>What is blood pH?</h3>

Blood pH can be defined as a measure of the molar concentration of hydrogen ions that are present in the blood of a living organism, with respect to its acidity, neutrality or alkanlity (basicity).

In response to a notification of a <u>decrease</u> in blood pH by the nervous system, the brain would send signals (impulses) to the external intercostal muscles and the diaphragm through its respiratory center, so as to help the living organism increase its breathing rate and the volume of its lungs during inhalation.

Read more on blood pH here: brainly.com/question/11209525

6 0
2 years ago
How do forestry, industry and agriculture contribute to water pollution? Write one complete sentence for each. *
Darya [45]

High quantities of nutrients in water from industrial crop fertilizers and animal waste cause excessive aquatic plant growth — a process known as “eutrophication,” which, in turn, causes “hypoxia,” or water that is low in oxygen. Harmful algal blooms (or HABs) occur when aquatic algae grow rapidly out of control.

5 0
3 years ago
Being able to understand and follow rules is an example of _<br> __skills.
ivanzaharov [21]

Answer:

how many letters are there before skills?

Explanation:

If there is two spaces then i have the wrong answer

5 0
3 years ago
Other questions:
  • Imagine that you are chatting with one of your friends, who stated that reptiles are obviously a monophyletic group, as this gro
    10·1 answer
  • What are some medicinal items from plants?
    15·1 answer
  • What are complementary base patterns? Why are they important?
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which family on the periodic table is least likely to enter into chemical reactions? 1, 18 ,2, 17
    10·1 answer
  • The ability to taste the bitter compound phenylthiocarbamide (PTC) is an autosomal dominant trait. The inability to taste PTC is
    14·1 answer
  • Describe the 3 main types of forest lands
    10·1 answer
  • Chlorophyll is green because what?
    8·2 answers
  • 5. A dedicated earth science student using
    13·1 answer
  • 3
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!