1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
13

cuales son las características principales que tienen en común las células eucarioticas y las procarioticas

Biology
1 answer:
ELEN [110]3 years ago
6 0

Answer:

The major similarities between cell types ( prokaryotes and eukaryotes ) are: Both have DNA (deoxyribonucleic acid) as a genetic material. Both are surrounded by a plasma membrane. Both have ribosomes.

Explanation:

if u need to, translate it on google to spanish

;D

You might be interested in
Why is the nervous system in the human body a system?
sleet_krkn [62]

Answer:

The nervous system helps all the parts of the body to communicate with each other. It also reacts to changes both outside and inside the body. The nervous system uses both electrical and chemical means to send and receive messages.

Explanation:

8 0
3 years ago
Read 2 more answers
The sequence below represents the organization of genetic information in the nucleus of the cell.One term in the sequence is rep
Shkiper50 [21]

The sequence with the correct word in place would be DNA --> Gene --> Chromosome

<h3>Organization of genetic information</h3>

The basic unit of genetic information is the gene.

Genes are made up of a base sequence of DNA.

Genes are organized into structures known as chromosomes.

Thus, DNA --> Gene ---> Chromosomes

More on genetic information can be found here: brainly.com/question/6663018

4 0
2 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Why was the cow insulin an effective substitute for the human insulin?
Ray Of Light [21]
Pork and beef insulins are similar to human insulin, differing only in one or a few amino acids. However, even a slight difference is enough to elicit an allergic response in some people. To overcome this problem, researchers looked for ways to make insulin that would more closely resemble human insulin.
6 0
3 years ago
Read 2 more answers
How do temperature and salinity affect deepwater currents?
WITCHER [35]

Answer: They create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them.

The temperature and salinity has a major impact on water current of oceanic water. The warm water is usually less denser than colder water, so it remains at the surface of water body, whereas the colder water being more in density remain in a depth. The salinity of cold water is more than the warm water.

According to the above explanation, they create density differences that cause dense deepwater currents to flow toward the equator where they displace less dense, warmer water above them is the correct explanation.

4 0
3 years ago
Read 2 more answers
Other questions:
  • The organic chemicals that help cell membranes to conserve internal fluids are____.
    11·1 answer
  • Can the work output of an engine be greater than the source of energy? A. yes, sometimes B. yes, always C. no, sometimes D. no,
    11·1 answer
  • How does the urban and natural water cycle compare?
    12·1 answer
  • How do the changes in heat and pressure, along with the changes in composition, serve to explain the changes in physical propert
    11·1 answer
  • A collection of stars, dust, and gas bound together by gravity is... a. universe b. solar system c. planet d. galaxy explain why
    6·1 answer
  • What can be burned in a lamp as a heat source
    7·1 answer
  • Approximately how far apart were north america and europe 200,000 years ago
    6·1 answer
  • How much DNA is located in an egg cell BEFORE fertilization?
    10·2 answers
  • When can an individual have an allele for a disorder but not have the disorder??explain
    8·1 answer
  • 1) The rate of evolutionary change  may be slow and steady  and is referred to as __________
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!