1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhuklara [117]
2 years ago
8

In order for translation to occur: Please choose the correct answer from the following choices, and then select the submit answe

r button. transcription must be occurring simultaneously. there must be large numbers of free amino acids present in the cytoplasm. the DNA must produce large numbers of free amino acids. replication must be occurring simultaneously. the nuclear membrane must first dissolve
Biology
1 answer:
sweet-ann [11.9K]2 years ago
4 0

Answer:

there must be large numbers of free amino acids present in the cytoplasm

Explanation:

<em>In order for translation to occur, </em><em>there must be a large number of free amino acids in the cytoplasm.</em>

<u>These free amino acids are usually carried by the transfer RNA which also carries the corresponding mRNA codon.</u>

During translation, as the codons in the mRNA match their complements in the tRNA, the amino acid being carried by the tRNA is released and a peptide bond is formed between subsequent amino acids until the required polypeptide bond is formed.

Translation and transcription only occur simultaneously in prokaryotic cells where there is no barrier between the cell's genetic materials and the cytoplasm, unlike in eukaryotic cells where the genetic materials are housed in the membrane-bound nucleus.

You might be interested in
Explain why cell differentiation is an important part of the development of a multicellular organism.
Arturiano [62]
Cell differentitation is important because our body's need different type of cells to grow and also function
8 0
3 years ago
What about cellulose makes it ideal for structural support?
gayaneshka [121]

Answer:

The answer would be D!

Explanation:

A hydrogen bond is one of the strongest molecular bonds.

3 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
2 years ago
Develop 3 questions about how genetic disorders are passed from one generation to the next, using the terms: DNA, chromosomes, a
Delicious77 [7]
Can certain diseases be hereditary?
Are genetic disorders passed though DNA?
Can we predict certain diseases based on certain chromosomes?
5 0
2 years ago
A sequence of organisms through which energy is transferred, beginning with the primary producer, is a _____.
algol [13]
<span>A sequence of organisms through which energy is transferred, beginning with the primary producer, is a "Food Chain"

Hope this helps!</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • The kingdom monera in the old classification system included all bacteria what two kingdoms now encompass prokaryotes organisms
    11·2 answers
  • What sedimentary rock is formed by evaporation of seawater?
    10·1 answer
  • In what organ is lactase typically produced
    10·2 answers
  • he concentration of a sugar is high inside a cell and slightly lower outside the cell. What is most likely to occur if the sugar
    12·2 answers
  • Which of the following would accompany a high-protein meal moving through the digestive system
    9·1 answer
  • How do the long strands of DNA fit into the nucleus of a single cell?
    7·1 answer
  • Water requires a very large amount of energy to undergo a change of state compared to most molecular compounds.
    13·2 answers
  • You discover an unknown protist. A section breaks off from the main protist specimen, and this piece develops into an adult prot
    8·1 answer
  • Guys how to make my hair tall and healthy
    5·2 answers
  • What covers the outside part of your body
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!