1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga_2 [115]
3 years ago
12

Rain shadow in a sentence

Geography
1 answer:
blagie [28]3 years ago
4 0
The Cascade Mountains create a rain shadow. Hope this helps!
You might be interested in
Let W be a point between points U and V on If UV = 13, UW = 2y – 9, and WV = y – 5, solve for y. A. 9 B. 11 C. 13 D. 27
valentinak56 [21]
U_____________W________________V
UV=13
UW=2y-9
WV=y-5

UV=UW+WV
UV=(2y-9)+(y-5)=2y-9+y-5=3y-14

13=3y-14
27=3y
y=27/3=9

Solution is A, y=9

7 0
3 years ago
HELP ASAP How can the development of a calendar and the construction of the pyramids demonstrate the Egyptians' knowledge of mat
Arlecino [84]
The development of the calander shows they can divde the number of minutes hours days month etc in a year. Development of the pyramids shows geometry and engineering. look up to make sure.
5 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
1. How did Washington travel to Richmond , Virginia !
Lerok [7]

Answer:

by wagon and horse

Explanation:

hope this helps!

-AlphaWolfie-

4 0
3 years ago
How are the northern part of the North European Plain and the lowlands of the West Siberian Plain similar?
Natalija [7]
The Northern European plain and lowlands of West Siberian Plains have a lot of differences in terms of their characteristics. The only similarity between the two would be the vast complex land that both of these lands have. 

I hope this answered your question.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Fault-block mountains form when large blocks of crust are _____ and tilted along normal faults. uplifted folded sunken
    14·2 answers
  • The boroughs of New York City are an example of __________ boundaries.
    14·2 answers
  • Who was the first person to reach the south pole?
    8·2 answers
  • In a turbite bed: Sediment is deposited chronologically. Sediment is deposited according to particle size. The top layer is the
    14·2 answers
  • What age range is<br>most of the population in?(population pyramid)​
    6·1 answer
  • BLANK involves aspects of food such as principles of food processing and strategies to improve food and nutritional value for pu
    14·1 answer
  • The way people eat in their country such as with forks,chopsticks or fingers is an example of
    11·2 answers
  • scientist recently discovered that the rocks collected from the Franklin mountains in West Texas and rocks collected from the mo
    7·1 answer
  • Answer the following questions based on the given pictures above. ​
    10·1 answer
  • When did the native american group come to the rain forest
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!