1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pashok25 [27]
3 years ago
11

Which of these creates a nonbiological impact on coral reefs ?

Biology
1 answer:
hjlf3 years ago
6 0
 What are the answer choices?
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The brain volumes ​(cm cubed​) of 20 brains have a mean of 1116.2 cm cubed and a standard deviation of 127.7 cm cubed. Use the g
Shkiper50 [21]

Answer:

Yes

Explanation:

Range rule of thumb predicts the Range to be  a multiple of 4 of the standard deviation or to be four times  the standard deviation. Making the usual values equal to 2 standard deviations distanct of the mean of the data distribution.

In a given distribution with mean and standard deviation that is obtained, the usual values in mean (as seen in the attached image).

2*standard deviation and mean + 2*standard deviation.

If the data point is not up to the mean

- 2* standard deviation is taken to be significantly low.

If the data point is more than the mean

+ 2*standard deviation is taken to be significantly high.

Let's take the xbar to be the mean and s as standard deviaiton

Given,

mean, xbar = 1116.2

standard deviation, s =127.7

The range rule of thumb shows that the usual values are within 2 standard deviations from the mean

Lower boundary

      = xbar - 2s

       = 1116.2 - 2(127.7)

       = 860.8

Upper boundary

      = xbar + 2s

       = 1116.2 + 2(127.7)

       = 1371.6

We should note that 1411.6 is not between 860.8 and 1371.6, which connotes that 1411.6cm^3 is unusually high.

3 0
3 years ago
Which cycle involves a gas moving from the atmosphere moving directly into
Taya2010 [7]

Answer:

B. The carbon cycle

Explanation:

In the carbon cycle, carbon in the atmosphere is absorbed into plants, where the plants use photosynthesis to convert that carbon into oxygen and energy for themselves. Neither of the other cycles involves a plant taking in a gas directly from the atmosphere.

Hopefully this was helpful! :)

5 0
3 years ago
The information in the passage supports the prediction that P. falciparum creates unique protein trafficking structures outside
-BARSIC- [3]

Answer:

A. PfEMP1

Explanation:

PfEMP1  stands for <em>Plasmodium falciparum</em> erythrocyte membrane protein-1. These antigens play a very important role in host immune invasion. Production of antibody against PfEMP1 antigens has been shown to contribute to natural immunity.

Malaria is associated with the parasites exhibiting an antigenically distinct <em>Plasmodium falciparum</em> erythrocyte membrane protein-1 subset thereby mediating binding to endothelial receptors.

8 0
3 years ago
Why would losing just a few dozen aquatic species lead to the end of life in the ocean as we know it?
Ilia_Sergeevich [38]

Answer: It would unbalance the ecosystem.

Due to the fact that if some species die off, the other species that rely on those species for food or protection would loose that food/ protection which may lead to their extinction and their extinction would lead to another extinction and so on.

8 0
3 years ago
Other questions:
  • A species of plant has exponential growth after it is introduced to an area where it has never been. Which statement best descri
    12·1 answer
  • In which step of the scientific method would you need controls?
    9·2 answers
  • 4. One end of magnet always point __ and is called __ pole.
    13·1 answer
  • In a controlled experiment what ter m is used to describe the many factors that might be different between the experiment and co
    12·2 answers
  • Higher frequency means what about the energy of the wave? * 1 point
    15·1 answer
  • Identify the labeled structures.<br> A:<br> B:<br> B<br> C:<br> А<br> D:<br> E:<br> D
    15·1 answer
  • (WILL GIVE BRAINLY) HELP SOMEONE PLEASE!!
    11·1 answer
  • Farmers are growing more genetically modified crops. Which of the following questions BEST helps determine the benefit to
    7·1 answer
  • Based on their names, you know that the baboons papio annubis and papio cynocephalus do not belong to the same.
    8·1 answer
  • Hall KT, Loscalzo J, Kaptchuk TJ. Genetics and the placebo effect: the placebome. Trends Mol Med 2015;21:285-94.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!