1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ksju [112]
3 years ago
10

The ridges of the stratum germinativum are called

Biology
2 answers:
Scilla [17]3 years ago
5 0
These are called papillae
irinina [24]3 years ago
4 0
Hey frnd

The ridges of d stratum is called papillae.

Hope this helps u frnd.
You might be interested in
What is the function of DNA polymerase answer ASAP please
pickupchik [31]

Great Question! <em>The function of DNA polymerase is to replicate, proofread and repair the DNA.</em>

5 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
What is it called when the atmosphere absorbs things and it goes into the clouds?
pochemuha

I believe the answer you're looking for is:

Condensation- If the air cools, then water vapor molecules slow down and some can not remain a vapor. They cluster in the air to form tiny liquid droplets. This is called condensation. In clouds, the liquid droplets formed by condensation are small and light enough that they stay in the air.

<em>hope this helps! :)</em>

5 0
3 years ago
Ecologists are studying the fire coral population in a 280-square-kilometer area on the Great Barrier Reef. Fire corals cannot m
Ray Of Light [21]

Answer:

B

Explanation:

6 0
3 years ago
Read 2 more answers
What are the primary components of panera bread's value chain?
vfiekz [6]

The value chain, Panera Bread's value chain has several component to its value chain, customer service, operating performance, and most important being inbound logistics. The most important for Panera Bread is the Priority on inbound logistics, as it is what differentiates their product from their competitors, which is their most important competitive advantage.
6 0
4 years ago
Other questions:
  • Why do some red blood cells undergo programmed death? They are healthy. The body must balance the blood cell count. Their concen
    9·2 answers
  • "why would stan be interested in taking a supplement containing chromium?"
    8·1 answer
  • What is the function of Vaculoes
    12·2 answers
  • During which stage can cells either exit the cell cycle or become committed to completing the cell cycle? hints during which sta
    7·1 answer
  • Ll in the blank.
    9·2 answers
  • A type of Algae grows on a sloth. What must be true for the algae and the sloth to have a commensal relationship?
    9·1 answer
  • If skeletal muscles work to the point of fatigue, the muscle cells may not have sufficient oxygen to carry out aerobic respirati
    7·2 answers
  • A person who is interested in finding a cure for diabetes, in which the pancreas does not produce insulin, might pursue a career
    9·2 answers
  • To differentiate between agarose gel electrophoresis and SDS-PAGE based on the following criteria:
    8·1 answer
  • Why is it important that a plant uses photosynthesis?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!