1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
6

¿Cuál es el mejor razón de utilizar una sonda de temperatura en lugar de un termómetro?​

Biology
1 answer:
torisob [31]3 years ago
8 0

Answer:

Explanation:

La mejor razón para usar una sonda de temperatura en lugar de un termómetro es registrar mediciones continuas durante varios minutos. La temperatura es la cantidad física que expresa el frío y el calor. Se mide con el termómetro.

You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Where does the light and thermal energy given off when burns food come from?
yawa3891 [41]

Answer: B

Explanation: Because Light and thermal are two different things of heat and if one of the cores of heat gets any cooler than it is than it may burn out and there wwill no longer be heat so the food brin come in at the middle (Core) of the heat and just like a microwave it had different heats but its core of the heat stays the excact same

5 0
3 years ago
Question 1 (1 point) Which of the following is NOT one of the four main elements of an amino acid? Question 1 options: Nitrogen
Irina18 [472]

Answer:

calcium is not a main element of calcium . question 2 hemoglobin is a globular protein with an embedded heme group. so a transportation protein and question 3 the building blocks of proteins are amino acids.

Explanation:

4 0
3 years ago
Diferencia entre las bacterias y los virus.
myrzilka [38]

Answer:

Los virus son más pequeños y no son células. A diferencia de las bacterias, necesitan un huésped como un humano o un animal para multiplicarse.

Las bacterias son organismos vivos unicelulares. Tienen una pared celular y todos los componentes necesarios para sobrevivir y reproducirse. Los virus no se consideran "vivos" porque requieren una célula huésped para sobrevivir a largo plazo, para obtener energía y para reproducirse.

Explanation:

6 0
3 years ago
Read 2 more answers
How are the law of independent assortment and the law of segregation different?
san4es73 [151]
Hi there!

The law of independent assortment says that the traits are randomly selected, there is no pattern to how they are sorted. The law of segregation says that the traits are divided between each gamete, using a pattern to sort them.

Hope this helps!! :)
7 0
3 years ago
Other questions:
  • Which part of a phospholipid is hydrophilic
    14·2 answers
  • Which process added new genes to a gene pool?
    14·1 answer
  • Tsunami waves flood coastal and inland areas and affect coastal life. Which of these properties of tsunami waves most contribute
    12·2 answers
  • The _________ division of the ans increases alertness. the __________ division has a calming effect on the body.
    12·1 answer
  • Doesn't have a science subject but okay.... Whoever helps will get brainiest
    5·1 answer
  • what organelles convert energy from one form to another, have their own dna, and are surrounded by a double membrane?
    5·1 answer
  • 8. Which of the following pairs accurately connects a macromolecule to its monomer? A. Carbohydrates–amino acids B. Nucleic acid
    9·2 answers
  • Which of the following does not happen when a cell divides?
    10·1 answer
  • Select the correct answer from each drop-down menu.disease. Some carriers of the disease exhibit Sickle cell disease is passed o
    14·1 answer
  • Meaning of flucking?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!