1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Colt1911 [192]
3 years ago
9

Inspiration:

Biology
1 answer:
Luden [163]3 years ago
4 0

Answer:

haha thats cute. im guessing there is no question in this?

You might be interested in
Some synovial joints contain special crescent-shaped pads that provide additional shock absorption, and provide for a better fit
Ksivusya [100]

Answer:

menisci

Explanation:

Some synovial joints such as that of knees have crescent-shaped pads. These pads are made up of fibrocartilage and are present between the articular surfaces of the bones. These cartilaginous pads are attached to the fibrous capsule and are called articular discs or menisci.  

The function of the menisci is to serve in shock absorption and minimize the wear and tear of the joint. Meniscus also allows the articulating bony surfaces to fit properly and facilitate an adaptable surface for combined movements. Meniscus serves to distribute the weight over a greater contact surface and thereby makes the joint stable. It also spreads the synovial lubricant across the articular surfaces of the joint.

5 0
3 years ago
What will happen to a cell that does not have a cell wall if placed in a
Verdich [7]

What will happen to a cell that does not have a cell wall if placed in a (b swell and burst )
5 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
The least amount of air movement in tropical rainforests is found in (the) _______.
Lady bird [3.3K]
<span>third layer of the canopy

</span>
4 0
3 years ago
Read 2 more answers
After a dye diffuses uniformly throughout a glass of water, the dye molecules are no longer moving. True or false?
Anton [14]
The answer is false, liquid molecules continue to move even after the concentration is uniform.

Diffusion happens because there’s a concentration gradient between the dye and the water, therefore dye molecules moves to the water area. But note that this is only the net movement of the molecules, which means, even if more molecules are moving towards water, there are still some dye molecules that are moving in the opposite direction.

So, after the concentration is equal, the motion of the dye molecules does not stop, they still move in random directions, but there’s no net movement instead, as there’s no concentration gradient. Remember molecules are always moving in all directions , it just depends on whether there’s a net movement or not. If there’s no net movement, the amount of molecules moving to each and every direction is always equal.
8 0
3 years ago
Other questions:
  • You have learned that tape or adhesive bandages must be removed carefully from the skin on patients who are elderly to avoid tea
    10·1 answer
  • What causes the water currents through the crayfish
    15·2 answers
  • An extreme-weather event has knocked out power in your community. Even with rebuilding efforts, it appears that it could be 6 mo
    5·1 answer
  • Which of the following is NOT a characteristic of all living things?
    15·2 answers
  • According to Craik and Lockhart (1972), the three levels of processing are __________, _________, and _________.
    5·2 answers
  • Explain why a child can have sickle cell anemia even if neither parent has the disease. previous next
    5·1 answer
  • cold front is associated with which of these? A. a rising cold air mass B. air masses that are not moving C. a cold air mass mov
    14·2 answers
  • Bonjour, comment ca va ?
    13·2 answers
  • g The indicated structures are the ________ that attach to papillary muscles on the floor of a ventricle.
    5·1 answer
  • Can someone plz help me? :(
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!