1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
3 years ago
12

How is hydrogen different from all the other elements?

Biology
2 answers:
Vikentia [17]3 years ago
8 0
A hydrogen atom is an atom of the chemical element hydrogen. The electrically neutral atom contains a single positively charged proton and a single negatively charged electron bound to the nucleus by the Coulomb force.
avanturin [10]3 years ago
4 0

It does not belong to any family of elements, and though it is a nonmetal, it appears on the left side of the periodic table with the metals. The other elements with it in Group 1 form the alkali metal family, but obviously, hydrogen does not belong with them.


You might be interested in
Write a hypothesis for Section 1 of the lab, which is about the effect the type of material has on the absorption of sunlight on
mojhsa [17]

Answer:

Explanation:

Different materials will change temperature at different rates when exposed to the same amount of heat. This is because the different materials absorb heat at different rates.

8 0
3 years ago
Read 2 more answers
An example for aheterotropic for feeding is what
vlada-n [284]

Answer:

Bacteria, fungi, yeast, cows, dogs, humans are all heterotrophs. They all depend on plants and other animals for their food.

6 0
3 years ago
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
erica [24]

Melting temperature of RNA duplex will be higher

Explanation:

  • RNA is a double stranded RNA with two complementary sequences
  • Duplex DNA is simply double stranded DNA
  • It is known A=U base pairs of duplex RNA is less stable than that of A=T base pairs of duplex DNA
  • RNA duplexes are considered to be more stable than DNA duplexes of comparable sequences but physical basis for thermal stability is not much known hence melting temperature of RNA duplex will be higher
5 0
3 years ago
The _______ helps to resist changes in pH.
olga_2 [115]
It is the blood helps to resist change ph
7 0
3 years ago
Read 2 more answers
What type of relationship where both organisms benefit
hammer [34]

Answer: mutualism!

hope this helps! recently learned about this. :D

4 0
3 years ago
Other questions:
  • An empty 1000 mL container has a mass of 250 g when filled with a liquid that container in the liquid have a combined mass of 13
    12·1 answer
  • Imagine that you are a study habit expert. Your class has a test and one of your classmates comes to you with a problem. Her fam
    9·2 answers
  • Which part of a leaf most protects leaves from drying out?
    13·1 answer
  • What are 3 reasons a virus is considered non living ?
    5·2 answers
  • An example of a positive feedback loop ________.
    15·1 answer
  • How do fronts change weather?
    8·2 answers
  • An interaction in which one organism captures and feeds on another organism is called
    12·2 answers
  • Rice yielding is more in jhapa, why?​
    8·1 answer
  • The allele for a blue skin color, B, is dominant to the allele b which codes for gray-colored skin. He decided to mate a lizard
    5·1 answer
  • comparison of dehydrated human amnion-chorion and type 1 bovine collagen membranes in alveolar ridge preservation: a clinical an
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!