1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex777 [14]
3 years ago
10

Explain what you think would happen to the everglades ecosystem if there were a sudden decrease in the number of crayfish.

Biology
1 answer:
weqwewe [10]3 years ago
6 0
The crayfish food chain would slow down
You might be interested in
If a population grows by 3 percent each year, the growth of the population is
Anettt [7]

Answer:

A. (exponential) population

8 0
3 years ago
Why is it important that nadp+ reductase is on the stromal side of the thylakoid membrane?
mina [271]
It is important that the FNR or Nadp+reductase enzyme is on the stromal side or covering of the plant's Thylakoid membrane because they participate in photosynthesis. NADPH cycling can only be achieved with light and cannot operate in the dark and stromal side provides the needed light.
5 0
3 years ago
Read 2 more answers
Which of the following statements about the dark reactions is true? a. Dark reactions occur in the thylakoids of chloroplasts. b
s344n2d4d5 [400]
The correct answer for the question that is being presented above is this one: "<span> d. All of the above." Th</span>e following statements about the dark reactions is true are the following: Dark reactions occur in the thylakoids of chloroplasts; Light energy is <span>converted to chemical energy during the dark reactions; Carbon dioxide is converted to sugar using ATP and NADPH during the dark reactions.</span>
8 0
4 years ago
What are macromolecules?<br> Marco=
Debora [2.8K]
Macro i beleive means small. so macromolecules are pretty much just molecules that are really small
8 0
4 years ago
true about niches? I. New species can outcompete native species to fill a niche. II. Extinction or emigration of a species can l
elena-14-01-66 [18.8K]
<span> I. New species can outcompete native species to fill a niche.
</span>

Niche is like a profession because everybody in our world performs a different job. Niche is somewhat defines like what you do, how you do it, where you do it and when you do it.In ecology, a niche is a term about the relational position of every species like dolphin. In where dolphin can potentially be in another ecological niche by travelling from one place to another. Profession are something like finding your specialty, your place and your niche in the world. 
6 0
4 years ago
Other questions:
  • Decide if the following sentences are true or false. You have to correct the false ones.
    11·2 answers
  • Zebra mussels, shown below, have recently been found in Colorado lakes.
    7·2 answers
  • What molecules make-up the sides of a dna molecule
    5·1 answer
  • What mechanism did darwin propose to supply the changes needed for evolution
    10·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of these germinal layers give rise to the digestive system, the circulatory system, and the nervous system?. . . . Endoder
    14·2 answers
  • How has science Impacted human helath
    12·1 answer
  • Can someone tell me the thing for these like the information for it pls
    9·1 answer
  • What's the definition of absoulute dating
    9·1 answer
  • Explique en que consiste el funcionamiento del SNC y SNP en el acto reflejo mencionando a lo menos 2 características del proceso
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!