Answer:
The correct answer is - the more specialized pharyngeal jaws are for one diet, the less adapted they are for the ingestion of other foods
Explanation:
Pharyngeal jaws are also called throat jaws and are specific for the prey. These jaws have strong muscles and plastic or easy-to-modify teeth. If an organism has pharyngeal jaws specialized for a specific diet or prey it will have lesser chances to adapted well according to the new diet. For instance, pharyngeal jaws highly specialized for scale eating will not be able to adapt well if the fish ingests algae.
Answer:
memory cells
Explanation:
to fight the reoccurrence of the invasion
We feel hotter in summer than in winter because the temperature is generally higher than in winter.
<h3>
What are seasons?</h3>
There are three seasons on earth namely winter, summer, and rainy season. In the winter season, the temperature is cold and during summer the temperature is higher.
Timing and characteristic of season depend upon the location of the earth. The time of a year region experience season depends on it is northern hemisphere or southern hemisphere.
The southern hemispheres experiences winter while northern hemisphere experiences summer. The cycle of seasons is caused by earth's tilted towards the earth. The planet rotates around an axis.
Therefore, We feel hotter in summer than in winter because the temperature is generally higher than in winter.
To learn more about seasons, refer to the link:
brainly.com/question/19009677
#SPJ2
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
