Answer:
ATP, water and carbon dioxide are produced.
Answer:
A pea plant that has round seeds has the genotype Rr. It is crossed with a pea plant that ... Gregor Mendel used pea plants that were heterozygous for each of two traits- seed colour and seep shape- to generate a dihybrid cross. The phenotypic ratio of the resulting offspring was nine with round and yellow seeds,
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
relative location is the position of something relative to another landmark. For example, you might say you're 50 miles west of Houston.
Firstly, humans did not evolve from monkeys. Instead, monkeys and humans share a common ancestor from which both evolved around 25 million years ago. This evolutionary relationship is supported both by the fossil record and DNA analysis. A 2007 study showed that humans and rhesus monkeys share about 93% of their DNA.