1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vodka [1.7K]
4 years ago
15

Which of the following statements is FALSE? Group of answer choices Ca2+ that activates contraction of smooth muscles can come f

rom either the ECF or from the sarcoplasmic reticulum. Synaptic input onto skeletal muscle cells is always excitatory, whereas inputs to smooth muscle cells may be either excitatory or inhibitory. Smooth muscle cells usually have one nucleus Contractile activity of smooth muscle cells does not normally require Ca2+. In the absence of any neural input, skeletal muscle cannot generate active tension.
Biology
1 answer:
ivann1987 [24]4 years ago
7 0

Answer:

Contractile activity of smooth-muscle cells does not normally require Ca2+.

Explanation:

There is deficiency of Smooth striations characteristic of cardiac and skeletal muscle in smooth muscle. Different organs and tube were lined with layer of Smooth muscle cell, though for contraction of Smooth muscle to occur, it's not a voluntary control

THE CONTRACTILE PROCESS

In the body of organism, the process of smooth muscle cell contraction is regulated through the activities of receptor and mechanical activation of myosin and actin which are reffered to as contractile proteins.

During the contraction process, myosin light chain kinase will phosphorylate the 20-kDa light chain of myosin, which will make the myosin to interact molecularly with actin to release Energy(ATPase). The Energy released is used for cycling of myocin and actin for contraction to take place.

Therefore,Contractile activity of smooth-muscle cells does not normally require Ca2+.

You might be interested in
What happens during aerobic respiration? A Oxygen is produced. B Glucose is produced. с Lactic acid and oxygen are produced. D A
Romashka [77]

Answer:

ATP, water and carbon dioxide are produced.

4 0
3 years ago
Gregor Mendel used pea plants that were heterozygous for each of two traits—seed color and seed shape—to generate a dihybrid cro
11Alexandr11 [23.1K]

Answer:

A pea plant that has round seeds has the genotype Rr. It is crossed with a pea plant that ... Gregor Mendel used pea plants that were heterozygous for each of two traits- seed colour and seep shape- to generate a dihybrid cross. The phenotypic ratio of the resulting offspring was nine with round and yellow seeds,

7 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Help Please!!! on the answer
Ierofanga [76]

Answer:

relative location is the position of something relative to another landmark. For example, you might say you're 50 miles west of Houston.

8 0
3 years ago
If humans evolved from monkeys, why are<br> there still monkeys?
Alina [70]

Firstly, humans did not evolve from monkeys. Instead, monkeys and humans share a common ancestor from which both evolved around 25 million years ago. This evolutionary relationship is supported both by the fossil record and DNA analysis. A 2007 study showed that humans and rhesus monkeys share about 93% of their DNA.

8 0
3 years ago
Other questions:
  • Select all that apply
    11·2 answers
  • The major threat to biodiversity is _____.
    9·2 answers
  • Conjunctivitis in a child that is accompanied by acute otitis media is treated with:
    5·1 answer
  • Why are flash floods more common in dry climates than wet climates?
    7·1 answer
  • Aim on how does the dominant hand and non-dominant hand react to stimulus
    5·1 answer
  • What makes these tumor suppressor proteins so important?
    9·1 answer
  • Which statements describe asexual reproduction? Check all that apply
    13·1 answer
  • The Renaissance began in Italy partly because __________.
    8·1 answer
  • Science 7.   Grade 7.
    9·1 answer
  • Which type of stress is shown in the image?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!