1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
3 years ago
11

What is the role of the hellicase enzyme in dna repication ?

Biology
1 answer:
Nikolay [14]3 years ago
5 0

Answer:

Explanation:

helicase. Helicases are enzymes that bind and may even remodel nucleic acid or nucleic acid protein complexes. There are DNA and RNA helicases. DNA helicases are essential during DNA replication because they separate double-stranded DNA into single strands allowing each strand to be copied.

This is the best way i can answer it

You might be interested in
Describe how the rabbit population changed over the course of 10 years.
valkas [14]
So, the population went up with every spring season and fell slightly in the winter; it increased within the course of 10 years
6 0
3 years ago
HELP ASAP!!!
Kitty [74]
<span>C. Several billion,,,,,,,,,,,,,,,,,,,,,</span>
8 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
[BWS.02]Which of these questions can be answered through science?
GREYUIT [131]

Answer:

Is wood heavier than paper

Explanation:

This is the only question that can have a definite answer and not an opinionated response

5 0
3 years ago
Read 2 more answers
What is one of the reasons why Gregor Mendel chose to study
Ipatiy [6.2K]

Answer:

Gregor Mendel was the father of the field of genetics, which seeks to explain how traits are passed on from one generation to the next. To study genetics, Mendel chose to work with pea plants because they have easily identifiable traits.

Hope This Helps!

8 0
3 years ago
Read 2 more answers
Other questions:
  • In science, a scientific theory is defined as a/an __________.
    5·1 answer
  • Sort the different barriers into their modes of reproductive isolation. A snail with a flat disc-like shell will not be able to
    9·2 answers
  • How are weeds alike and different than plants/flowers?
    13·1 answer
  • Which structure is a sealed capsule of clear fluid that focuses light to the back of the eye? A. cornea B. iris C. lens D. retin
    8·1 answer
  • How does the “fluid mosaic model” describe the structure of the plasma membrane?
    6·1 answer
  • How can a hunter help wildlife conservation efforts? A, By making sure to always obey the rules of firearm safety By making sure
    11·2 answers
  • Which is NOT an example of a renewable energy source?
    6·2 answers
  • Cellular respiration and photosynthesis are similar in that both require
    9·1 answer
  • What would happen if I hired two private investigators to follow each other?
    5·2 answers
  • Which of these is not a producer?<br> A. leopard<br> B. Fern<br> C. apple tree
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!