1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka94
3 years ago
8

Can someone help me plzzz... essay about global warming..and thank u guys

Biology
2 answers:
ryzh [129]3 years ago
7 0
I can give you a clue


Global warming is cause by deforestation
write you own words
Snowcat [4.5K]3 years ago
5 0
We would need more details. Do you need to follow a rubric? Do you have any specific rules? Exactly what about global warming? How long of an essay? What’s the minimum and maximum about of pages. Is this typed, or written? Is there any specific information you’ve learned this unit that you need to include?
You might be interested in
Which properties describe all matter?
makvit [3.9K]

The physical properties describes all matter. Physical properties are color, length, volume, odor, and density have same essence and definition for all matter the only thing which changes is the variation in composition and quantum in each matter that give different values for the same physical properties for different matter



6 0
3 years ago
Which of the following situations correctly illustrates the all-or-none principle?
r-ruslan [8.4K]

Answer:

37373773773738383828292929918283733737373733747744774

6 0
3 years ago
Carol is enjoying eating her dinner. While eating, she notices that her saliva secretion is higher than normal, and that she fee
34kurt

<span>Parasympathetic nervous system
</span><span>
The nervous system has three general functions: a sensory function, an interpretative function and a motor function. 1. Sensory nerves gather information from inside the body and the outside environment. The nerves then carry the information to the central nervous system (CNS). 2. Sensory information brought to the CNS is processed and interpreted. 3. Motor nerve cells convey information from the CNS to the muscles and glands of the body. The nervous system is responsible for coordinating all of the body's activities.</span>
4 0
3 years ago
Read 2 more answers
"a lake is one example of local base level.<br> a. true<br> b. false"
nikklg [1K]
The answer is true hope this helps
7 0
3 years ago
A type of cellular transport is shown. Which description best identifies this type of cellular transport? Your answer: A.Osmosis
garri49 [273]

Answer:

C

Explanation:

7 0
4 years ago
Other questions:
  • HELP!!!!!!!!!!
    12·1 answer
  • Structure describes the alpha-helices and beta-sheets that are formed by hydrogen bonding between backbone atoms located near ea
    10·1 answer
  • Summarize the relationship between water, carbon dioxide, carbonic acid, bicarbonate and hydrogen
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • (Write a brief summary for people who aren’t familiar with the science of bringing back extinct species). This section should be
    10·1 answer
  • Explain the flow of energy from the sun to sunflower and then on to a cardinal that ate the sunflower seeds. How did the energy
    12·1 answer
  • All of the following are major sources of nutrient pollution except
    8·2 answers
  • Which of the following statements about complete metamorphosis is true? will give brainliest
    9·1 answer
  • In order to call a cardiac rhythm paroxysmal supraventricular tachycardia you would have to:___.
    8·1 answer
  • in the background section, it is noted that inhibition of protein synthesis blocks cell division in sea urchins. this observatio
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!