1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svet-max [94.6K]
2 years ago
5

Please choose the answer that describes the scientific notation for 3,134,000,000

Biology
2 answers:
bekas [8.4K]2 years ago
5 0
3.134×10^9=3,134,000,000
miskamm [114]2 years ago
3 0
The scientific notation for that is

3.134 * 10^9

This is because you move 9 places then put it to a exponent.
You might be interested in
Why would an athlete have a big pasta dinner the night before a race?
gulaghasi [49]
Because he/she needs to store large quantities of energy that he/she would require for the race. Pasta mainly consists of wheat which a carbohydrate. carbohydrates are primary source of energy in the body. once an athlete consumes pasta, starch in the wheat will digested to produce excess glucose which will be stored in form of glycogen in the live by the help of hormone insulin. during the race day, when an athlete uses all glucose in the blood, glycogen is converted to glucose through the help of hormone glucagon. glucose is transported to skeletal muscle cells where it is converted to energy.  
7 0
3 years ago
B=black and b=brown. A Bb guinea pig crosses with a Bb guinea pig, and four offspring are produced. All of the offspring are bla
xeze [42]
Simple, both guinea pigs have the dominant B traits in them, and the DNA code combines to make the dominant trait the one most present in the offspring.
3 0
3 years ago
Which is a major factor affecting population growth rate? (Site 1)
iVinArrow [24]

Answer:

resources        

Explanation:

5 0
3 years ago
Read 2 more answers
Even land that is now very diverse once started out as what?
evablogger [386]

As of right now, the land is pretty spread out. But millions of years ago, like, we're talking dino time, all the land was just one chunk. This chunk was called Pangaea, or Pangea. But before everything split apart into multiple continents, there was just one; a supercontinent. Hope that helps!

8 0
3 years ago
Anyone know the answer???
KATRIN_1 [288]

Answer:

what is the question

Explanation:

I does not know wnser

6 0
2 years ago
Other questions:
  • Which best describes the current thinking about stress response and the immune system?
    10·1 answer
  • What are the important animal groups that evolved from amniotes? What in turn, evolved from these groups?
    11·1 answer
  • When doing medical research with human subjects,which four limitaions are unavoidable
    12·1 answer
  • The endosymbiotic theory states that chloroplasts and mitochondria evolved as a result of
    9·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What are two proteins within cell growth that are internal factors?
    7·1 answer
  • The nitrogenous bases in DNA are held together by... A. Covalent Bonding
    9·1 answer
  • Why rapidly digestible starch good for weak person and slowly digestible starch is good for diabetic person
    9·1 answer
  • Explain Natural Selection
    14·2 answers
  • The list shows some of the livestock being raised in South Dakota.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!