1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
5

True or False? Circle the correct answer for each statement. If a statement is false, explain why under the

Biology
1 answer:
Lorico [155]3 years ago
4 0

Answer:

F,T,T,F

Explanation:

1)false-(its a covalent bond)

A water molecule is formed when two atoms of hydrogen bond covalently with an atom of oxygen.

2)True-(water is a polar molecule)

Water is a polar molecule because the positive end attracts particles of negative charge.

3)True

water dissociates to form hydrogen ions (H3O+) and hydroxide (OH-) ions

4)false

Lower pH number means stronger acid, higher pH number means stronger base.

You might be interested in
18. Primary sex characteristics have to do with
CaHeK987 [17]

C. <u>Secondary</u> sex characteristics include; increased fat deposits in *Breasts, thighs, & butt for females.* & *Penis & butt for males* and more.

5 0
3 years ago
What was the first eon of the Precambrian?A. PaleozoicB. HadeanC. PhanerozoicD. Archean
poizon [28]

Hadean is the first eon of precambrian, and took place around 4.6 and 4.0 billion years ago.

6 0
1 year ago
Please Explain thanks
ikadub [295]
A is the sun hope this can help
3 0
3 years ago
Read 2 more answers
Recommend an action humans could take to help prevent the extinction of tropical organisms
Art [367]

Answer:

Stop habitat destruction

Explanation:

Cutting down and burning forests basically take away the shelter, hunting grounds, and overall habitat away from many species that use the trees as a form of shelter and protection. Removing their shelter, which could be their only form of protection causes many of these organisms to die, not to mention the plants that are necessary to keep the food chain balanced.

6 0
2 years ago
What is the meaning of abs?
umka2103 [35]

Answer:

automatic basic science

4 0
2 years ago
Read 2 more answers
Other questions:
  • Which of these is another name for an educated guess?
    13·1 answer
  • 1. The image shows a flower that was produced by crossing a pure red flower with a pure white flower. Which do you think is the
    8·1 answer
  • The three stages in the development of a full tropical cyclone are formative, mature, and
    8·1 answer
  • Which statement BEST describes the theory of natural selection?
    13·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • You are a pharmaceutical researcher trying to design a new drug for the treatment of cystic fibrosis. You are aware that an extr
    7·1 answer
  • Neutral atoms have equal amounts of protons and electrons <br><br> true or false
    15·1 answer
  • A recipe calls for 34 teaspoon of butter for every 2 cups of milk. If you increase the recipe to use 3 cups of milk, how many te
    9·1 answer
  • Albinism is caused by a recessive mutation. If two albino mice mate and produce offspring with normal pigmentation, what could y
    11·1 answer
  • Insect hormones and their receptors ________. A. act independently of each other B. are a focus in pest control research C. util
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!