1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergio [31]
3 years ago
8

What theory proposes that evolution occurs suddenly and tiny changes over long periods of time

Biology
1 answer:
choli [55]3 years ago
6 0

Darwinian or Neo Darwinian theory of Evolution.


You might be interested in
True or false: The drug Salvarsan was used as treatment for syphilis in the early twentieth century.
Mama L [17]

Answer:

True.

Explanation:

in the early 1900s development of Salvarsan, an arsenic-based drug to treat syphilis.

5 0
2 years ago
Mr. Smith has found a lump under his arm. He goes to his doctor, and the doctor confirms that the lump is cancer. How are cancer
rodikova [14]

Answer:

C

Explanation:

I believe this is the answer.... UWU

6 0
3 years ago
What goes on at the center of earth?
Natasha_Volkova [10]
Lava is at the center of the earth witth lava 
7 0
3 years ago
Read 2 more answers
A scientist claims that volcanic eruptions caused dinosaurs to become extinct at this location. Decide whether you agree or disa
larisa86 [58]

Answer:

Dinosaurs are the extinct organisms that belong to the class reptilia. Dinosaurs are the most advanced and bulkier reptiles at the history time and they were overspecialized in their environment.

The dinosaurs extinct rapidly due to the change in the external conditions and the volcanic eruptions that occur at the dinosaurs time. The recent searcher claims that asteroid impact and massive volcanic eruption leads to the dinosaur extinction. The fossil evidence and the presence of the specific basalt and other chemicals are found in the volcanoes and in the asteroid.  

8 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • What is not characteristic of primitive mammals?
    13·2 answers
  • Which planets are classified as terrestrial? Jupiter, Saturn, Earth, and Mars Mercury, Venus, Earth, and Neptune Jupiter, Saturn
    7·2 answers
  • Which best describes the relationship between population size, carrying capacity, and limiting factors?
    10·2 answers
  • What happens in Citric acid cycle?
    12·1 answer
  • What is a plate cell?
    11·1 answer
  • You want to determine the various species of birds in your backyard. Identify three sources that you could use to
    6·1 answer
  • Which organism below receives 10% of the available energy?
    9·1 answer
  • What are some potentially linked genes you think humans might have?
    8·1 answer
  • Which sequence represents part of the normal flow of blood?<br><br> PLEASE HELP
    14·1 answer
  • 2.The blood-sucking parasites which attack the outside of the host are called __.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!