1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
10

Cats are smaller animals than humans. Which would you expect to have a (relatively speaking) more active thyroid glan

Biology
1 answer:
Sergeu [11.5K]3 years ago
4 0

Answer:

A final conclusion is not possible from this information

Explanation:

In mammals, the thyroid is an endocrine gland composed of two lobes that are connected by a bridge of tissue referred to as thyroid isthmus. The thyroid gland produces different types of hormones including calcitonin, triiodothyronine and thyroxine. These hormones are known to increase basal metabolism and thus affect metabolic-associated mechanisms including appetite, nutrient absorption and gut motility. However, thyroid hormones are not directly associated with the growth rate. It is important to note that the growth hormones are synthesized by the pituitary gland.

You might be interested in
Why are plants and animals considered multicellular
wolverine [178]

Answer:

They're made of more than one cell

Explanation:

5 0
3 years ago
The megasporangium in a pine cone is surrounded by an integument with a small opening called the?
zhannawk [14.2K]

The megasporangium in a pine cone is surrounded by an integument with a small opening called the micropyle.

Integuments in flowers are the maternal tissues or having a maternal beginning, as they originate from the ovular tissue or chalazal tissue (part of the lady reproductive gadget of a flower). A time period integument merely refers to the protecting layer. In terms of botany, an integument is a layer encircling the ovule.

A mature ovule consists of a meal tissue included by means of one or destiny seed coats, called integuments. A small establishing (the micropyle) within the integuments permits the pollen tube to enter and discharge its sperm nuclei into the embryo sac, a large oval cellular in which fertilization and improvement arise.

Learn more about integument here: brainly.com/question/2801375

#SPJ4

3 0
1 year ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What are the structural characteristics that give the phosphoanhydride bond its high-energy status?
Bas_tet [7]

Answer:

The answer to the given question out of the four options provided is given by:

Option a. Hydrolysis products are more resonance stabilized.

Explanation:

The answer selection to the above question can be justified as Phosphoanhydride on hydrolysis releases free high energy as the bonds formed by phosphoanhydride are the bonds with high energy.

Therefore, the product of hydrolysis after releasing this energy is more resonance stabilized.

5 0
3 years ago
Explain the structure of DNA and function of DNA.
prisoha [69]

Answer:

Explanation: DNA is the information molecule. It stores instructions for making other large molecules, called proteins. and the function of DNA is To carry out these functions, DNA sequences must be converted into messages that can be used to produce proteins, which are the complex molecules that do most of the work in our bodies.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of these is a common characteristic of cnidarians?
    7·2 answers
  • What is an adaptation for cold,snow -covered environments
    14·1 answer
  • All of the following are caused by water erosion, except:
    14·1 answer
  • Given these characteristics of life, which of the following objects is considered a living organism
    10·1 answer
  • Which of the following statements is false?Algae are used to make many commercial products, like marshmallows and paint.Algae ca
    15·1 answer
  • All fungi are considered Group of answer choices auto/heterotrophs, cell wall made of peptidoglycan, prokaryotic heterotrophs, t
    5·1 answer
  • Las 4 partes externas del riñon cuales son Plisssss
    11·2 answers
  • This is due at 11:59 please helpppppoo
    7·1 answer
  • Macromolecules inside of foods can be large polymers or small monomers
    9·1 answer
  • Could someone please help me ASAP!!!
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!