1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zhenek [66]
3 years ago
13

During which step of meiosis do homologous chromosomes pair up?

Biology
1 answer:
katrin2010 [14]3 years ago
5 0

Answer:

<u><em>PROPHASE</em></u>

Explanation:

The first stage in Meiosis I is prophase I. During this stage the DNA condenses into chromosomes. During prophase I, homologous chromosomes pair up and exchange sections of DNA. This is called recombination or crossing over

You might be interested in
The portion of the biosphere that consists of all earth's land is called the _____
Marizza181 [45]
Lithosphere is the correct answer
cause hydrosphere is water
and stratosphere and atmosphere are part of the air
8 0
3 years ago
Pick the odd one out: Nucleus, Mitochondria, Plastid, Lysosome. Give reason for your answer.
olga nikolaevna [1]
Nucleus, Mitochondria, and Lysosomes are found in a cell. Plastid is the odd one.
5 0
3 years ago
Read 2 more answers
Look the attachment please!
Alenkinab [10]

The following tests can determine the mineral in a rock specimen:

1. How does the rock crumble or split under pressure?

2. What is the texture of the rock?

3. Observing it under a magnifying lens.

4. Determine the color of the rock



Test 1 and 3 determines if the rock is granular and the types of grains in the rock. Test 3 also determines if the rock has layers hence sedimentary rock.

Determining whether color of the rock is dark or light also helps identify the mineral and type of rock.



5 0
3 years ago
Xplain how the study of taxonomy helps other scientists.
adell [148]
It helps classify animals according to their needs.
Hope this helps!

-Payshence xoxo
8 0
3 years ago
The tRNA lines the amino acids up to form...
ivanzaharov [21]
2, they line up to form a polypeptide chain this forms part of a protein molecule.
3 0
3 years ago
Other questions:
  • How do you think the nervous, epithelial, connective, and muscle tissues in your stomach work together in the process of digesti
    12·1 answer
  • Which of the following terms helps to describe an ecosystem? Select one of the options below as your answer:
    13·1 answer
  • Compare and contrast the circulatory system of plants and animals.
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • GIVING BRAINLIEST!!!
    11·2 answers
  • One of the chromosomes in a nucleus has a telomere which contains many repeats of the base
    10·1 answer
  • What features relate cephalopods to other mollusks
    6·1 answer
  • A protein that is bound to a carbohydrate is called a.
    9·1 answer
  • Which represents a negative impact of technology?
    14·2 answers
  • List down the food items that are generally spoiled by the presence of bacteria
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!