What do corn syrup and water have to do with solvent and solute she?

1 answer:

6 0

Water is the universal solvent; a solvent is what does the dissolving. The corn syrup would be the solute, in other words what gets dissolved.

You might be interested in

Insulin and glucagon are both hormones that work opposite of eachother explain what each of these hormones regulate ???

Nostrana [21]

Insulin controls blood sugar by lowering it, glucagon tells the liver to release its stored sugar into the blood stream, increasing blood sugar.

3 0

3 years ago

The origin of a muscle is generally:

Cloud [144]

D. the moveable and proximal attachment

6 0

3 years ago

Read 2 more answers

Describe the events of each stage of mitosis

seraphim [82]

Mitosis consists of four basic phases: prophase, metaphase, anaphase, and telophase. ... These phases occur in strict sequential order, and cytokinesis - the process of dividing the cell contents to make two new cells - starts in anaphase or telophase. Stages of mitosis: prophase, metaphase, anaphase, telophase.

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

You are studying droplets of various solutions and comparing them to water. what shape do they start as?

cricket20 [7]

In the case of liquid droplets, including water, surface tension is the factor, which is accountable for their shapes and configuration. Though can easily be malformed, the droplets of water seem to be pulled into a spherical shape due to the cohesive forces of the surface layer.

In the non-existence of other forces, involving gravity, the drops of almost all the liquids would be almost spherical.

5 0

3 years ago

Read 2 more answers