1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bagirrra123 [75]
3 years ago
15

What makes a hypothesis scientifically useful ?

Biology
2 answers:
AlekseyPX3 years ago
6 0

Answer:

it can be tested

Explanation:

puteri [66]3 years ago
4 0

the answer would be that it can be tested.

A hypothesis is only scientifically useful if it is testable and falsifiable.

You might be interested in
What is the missing value?
Darya [45]

Answer:

from where. can you PLZ put up the diagram or graph

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which statement is one component of the cell theory
Degger [83]

Answer is that the cells exist inside the body

Explanation:

i went to science class 1 time in freshmen year

8 0
3 years ago
Read 2 more answers
How are soil and plant taxonomy the same
Lerok [7]
They are both used to benefits plants growth process.
6 0
4 years ago
What did the discovery of radioactivity do to change the geological time scale?
Gemiola [76]

yes Answer:

Explanation:

bc yes

5 0
3 years ago
Read 2 more answers
Other questions:
  • What are the three pairs of salivary glands?
    7·1 answer
  • How to be seccesfull?
    8·2 answers
  • How old is the planet
    13·1 answer
  • One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes
    8·1 answer
  • _____ refers to the activation, often unconsciously, of certain associations, thus predisposing one's perception, memory, or res
    12·1 answer
  • Why are covalent bonds form when an electron is completely lost or gained from an atom
    8·1 answer
  • What si the answer ? Somebody pls smart peopdn
    5·1 answer
  • Explain the application of the principle of genetics in agriculture and medicine
    13·2 answers
  • Please help! Cells inside the body work to keep the dog's temperature stable. True or False?​
    6·2 answers
  • Describe the three methods for harvesting stem cells, for each method, explain the benefits of the method and the ethical concer
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!