1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
EleoNora [17]
3 years ago
15

All of the following are considered earth sciences EXCEPT A) biology Eliminate B) geology C) oceanography D) geography

Biology
2 answers:
Naya [18.7K]3 years ago
7 0
A) biology is the right answer
Ray Of Light [21]3 years ago
3 0
Your answer is C. oceanography
You might be interested in
Identify 3<br> organisms that<br> belong to Kingdom<br> Animalia.
Nadusha1986 [10]

Answer:

Fish: Tilapia Mammals: Bears and Amphibians: Frogs

Explanation:

6 0
3 years ago
Greater omentum belongs to what organ system
ANEK [815]
It belongs to the Digestive system
6 0
3 years ago
Which two species do you infer are the least closely related to humans?
konstantin123 [22]

Answer:

Got this

Explanation:

Any type of bug

Sponges share virtually no genetics with humans although they are animals.

3 0
3 years ago
Do venus fly traps have to be in direct sun light or shade
TEA [102]
The Venus Fly trap requires a lot of sun to grow healthy and create the energy it needs through photosynthesis. The preferred conditions are to keep it in an area where it will get direct sunlight. If indoors I would recommend placing it by a window or under a heat lamp.

I hope this helps!
4 0
3 years ago
Read 2 more answers
Which of the following could represent a good pattern of integrated pest management?
Talja [164]

Answer:

Tail docking, crutching, mulesing, insecticides, crop rotations, fly traps, grazing management, pesticides

7 0
3 years ago
Other questions:
  • Mitosis is responsible for what key process in multicellular eukaryotes?
    7·1 answer
  • Name a biotic factor in the room you are in right now?<br><br>i am in a classroom
    7·2 answers
  • What does it mean to say that there is a "proofreading" function in DNA replication?
    12·2 answers
  • When you drop a rubber ball, gravity pulls the ball to the floor. When the ball hits the floor, it becomes
    15·1 answer
  • All eukaryotic organism contain cell with
    9·1 answer
  • Adam finds a fossilized shell with thin growth lines. Which of the following is the most likely conclusion?
    9·2 answers
  • Hormones trigger facial hair growth in a maturing male____&amp;_______systems
    9·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What is the genotype of person #1
    11·1 answer
  • If you have done the Genetic engineering gizmo please help me
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!