The bottleneck event that decimated the bison was caused by _______.

1 answer:

7 0

The answer is an overhunting.

<span>The bottleneck event means drastic reduction of the population size because of environment changes. The consequence of this is the reduction of genetic variation. The bison population is a good example of the population bottleneck. The bison population drastically reduced its size due to overhunting which culminated at the end of the 19th century, when bisons almost extinct. </span>

You might be interested in

The diagram shows the five kingdoms of life. The place where the circles intersect include

Dimas [21]

Well it’s not the prokaryotes because that’s bacteria and archaea. Eukaryotes is your best bet because the two do fall under that category.

When it comes to the multicellular or unicellular protists are MAINLY unicellular while plante, animalia and fungi only are all multicellular so if they were in the same circle that’s probably while they are separated in the first place.

I would pic eukaryotes!
Hope this helps!

7 0

3 years ago

Does cell respiration occur in the plastids ?

RSB [31]

Answer:

Yes it does,

Explanation:

Cellular respiration occurs in both plant and animals. It is the process by which cells convert ADP (adenosine diphoosphate) into ATP (adenosine triphosphate). Plant and animal cells cannot use ADP as a form of energy.

7 0

4 years ago

If a population overshoots its ___ it may have a population crash

Olenka [21]

Birth rate, As we grow we might have to cut down on birth

7 0

2 years ago

Which mRNA sequences would form a structure that is a cue for transcription termination of some genes? 5′−GGCCCUUUUACCCGGUUUU−3′

Blizzard [7]

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"