1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miskamm [114]
3 years ago
7

Where are valance electrons located in an atom?

Biology
1 answer:
loris [4]3 years ago
6 0
Valance electrones are located in the very last shell of the perticular atom. And hence, the shell is known as valance shell of the atom.
You might be interested in
Assume that Tay-Sachs disease only affects homozygous recessive individuals. If two parents are carriers, what are the chances t
babymother [125]
25% chance
If you understand how to use a punnett square it would help you out a lot for these problems.(;
7 0
3 years ago
What of the following is not a form of potential energy?
Bess [88]
A, electro magnetic is not a form of potentional energy
4 0
3 years ago
Read 2 more answers
As streams flow through Stone Mountain, layers of sand build up. Over time, the sand particles form a sedimentary rock called sa
faust18 [17]

Answer:

High heat and pressure cause the rocks to become metamorphic. presses and presses down onto the rock, making it stay and compress down

6 0
3 years ago
Read 2 more answers
What part of the cell contains genetic material?
jonny [76]
The chromosomes contain the genetic material which are located in the nucleus 
7 0
3 years ago
What group of organisms are responsible for capturing energy within ecosystems
Marina86 [1]

The type of organisms that take energy by eating up other organisms in an ecosystem are called 'CONSUMERS'. Now these consumers are further divided into three major classes:

1. Primary consumers: this type of consumers feed directly from the producers (plants) and they only eat grass, leaves, vegetables, etc. Such animals are also called herbivores. Example: rabbit

2. Secondary consumers: these are the animals that eat up primary consumers (animals that feed only on plants). These animals are called carnivores. Example: snake

3. Tertiary consumers: animals that eat carnivores which eats a herbivore are called tertiary consumers. They can be completely carnivore or omnivore (who feed on animals and plants both). Example: humans (they feed on animals and plants both)

4 0
3 years ago
Other questions:
  • A human female has _____ chromosomes in each skin cell and ______ chromosomes in each egg.
    10·1 answer
  • You are a pelican searching for fish in the ocean from high in the sky. although you see no tasty fish in the open ocean, you so
    11·1 answer
  • What solution is needed to test for vitamin c​
    5·2 answers
  • Enzymes act as catalysts because___
    11·1 answer
  • RNA is translated into protein by using ______________
    8·1 answer
  • Offspring that result from crosses between true breeding parents with diffrent traits are
    6·1 answer
  • The light intensity may not give the farmer maximum profit. Explain why.
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Hormones for glucoregulation are secreted by a gland called??<br><br> HELP ASAP PLZ
    11·1 answer
  • Definition: Any living thing with one or more cells.<br> Example: You<br> Term?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!