1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faust18 [17]
3 years ago
6

Which of the following best expresses the concept of natural selection?

Biology
1 answer:
storchak [24]3 years ago
4 0

Answer:

The correct answer is - option A. differential reproductive success based on inherited traits

Explanation:

Natural selection is the differential reproductive and survival of particular population due to the difference of shared characteristics that are inherited in a specific environment. In other words natural selection is differential reproductive success based on inherited traits.

The term differential reproductive success is suggests that comparing and analyzing successful reproduction rates between groups statistically which means how many individuals of the population left behind due to not inheriting traits require for survival.

Thus, the correct answer is - option A. differential reproductive success based on inherited traits

You might be interested in
The Devonian marked the time of greatest diversity in which of the following?
USPshnik [31]
I would say that the fishes exhibited the greatest diversity (though the brachiopods also had considerable diversity) and mostly were of the ostracoderms (with a platey or shell-like skin and no jawbone) which exhibited many varieties and also the placoderm which had gills, a jawbone and fins so was developing characteristics of modern fish. 
5 0
3 years ago
An enzyme known as amylase is found in the saliva of humans. This enzyme helps to begin the process of digesting starch molecule
Anettt [7]

C,the answer is C because enzymes are catalysts,they help speed up reactions.


5 0
3 years ago
Space probes can
Ivahew [28]

Answer: The answer is D. All of the above

3 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Match the enzymes with the molecules they help break down<br> a. Amylase<br> b. Pepsin<br> c. Lipase
Vika [28.1K]

Answer:

The correct  matches are given as follows:

a. Amylase - Starch

b. Pepsin - Protein

c. Lipase- fats

Explanation:

The digestion can be defined as the breaking down of the complex compounds of food into simpler compounds for their better absorption. There are various enzyme that help in the process of digestion. Amylase, pepsin, and lipase are enzymes.  The amylase is an enzyme responsible for breakdown of starch. The pepsin is responsible for the breakdown of protein into amino acids. The lipase is responsible for breakdown of fats.

3 0
3 years ago
Other questions:
  • Describe the effects that enzymes can have on substrates amoeba sisters
    15·1 answer
  • What do scientist now think of the theory of vitalism
    8·1 answer
  • An air mass that originates in the Pacific ocean, west of Brazil, is most likely
    10·1 answer
  • Landfills are waste disposal sites. They are often man-made depressions in the ground covered with a lining designed to prevent
    7·2 answers
  • Cellular respiration is a multipathway process that converts an organic substrate into cellular energy. The majority of energy i
    8·1 answer
  • The integumentary system is an organ system consisting of the skin, hair, nails, exocrine glands, and sensory nerves. What helps
    12·2 answers
  • Alex accidentally left a bag of carrots in the warm car. When he found them, they had
    15·1 answer
  • The jellylike substance that holds everything in place inside all cells is called the....
    13·1 answer
  • Which is the least complx thing in our body
    6·1 answer
  • Engineers often use designs that mimic shapes found in nature, such as flippers, wings, and beaks. Construct an argument that su
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!