1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
CaHeK987 [17]
3 years ago
5

1. Read the excerpt from The Building of Manhattan.

Biology
2 answers:
nirvana33 [79]3 years ago
6 0

2. In 1945 a U.S. Air Force bomber accidentally crashed into the Empire State Building, killing fourteen people and damaging the 78th and 79th floors.  

4. No infinitives are used. Sentence 4 contains a gerund.

5. includes Steve writing about himself in the first person.


That what i got and if any incorrect then sorry I try my best.


elena55 [62]3 years ago
6 0

Answer:

2. Which of these is a summary of the text?

answer is A: In 1945 a U.S. Air Force bomber accidentally crashed into the Empire State Building, killing fourteen people and damaging the 78th and 79th floors.

Explanation:

You might be interested in
Explain the importance of atp in muscle contraction and regulation
Alex_Xolod [135]
If you don't have atp you would be pluralized <span />
7 0
4 years ago
When electrons are slowed down they end up producing __________?
tangare [24]

Answer:

Explanation:

Gamma heat waves

3 0
3 years ago
Read 2 more answers
Behavior can best be defined as
sertanlavr [38]

Answer:

Behavior is best defined as anything a person says, does, or feels.

7 0
3 years ago
Climate is defined by all of the following except for:________.
Natalka [10]
C.
climate is defined by all of the following except for: governs fresh water supply, type of crops, distribution of plants and animals
4 0
2 years ago
Explain where the pericardium is found and what it does for the heart?
Julli [10]

Answer:

The pericardium is the most outer layer of the heart. Main function to protect the heart from external forces/entry.

5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What process is considered to be growth when it occurs in multicellular organism reproduction when it occurs in a unicellular or
    12·1 answer
  • Which condition, other than bph, would you expect to cause a rise in the level of prostate specific antigen (psa)? which conditi
    7·1 answer
  • How can the actions of one species help or harm other species?
    14·1 answer
  • The diagram below shows a close-up of blood vessels in the human body. What structures are labeled X in the diagram? What import
    6·1 answer
  • You want to study the effect of agriculture run-off on the rate of antibiotic resistant bacteria in ponds. You gather samples fr
    14·1 answer
  • Can someone tell me if i did number 3 right and if it’s wrong can you correct me:)?
    8·2 answers
  • PLEASE HELP IN ONE MINUTE WILL MARK BRAINLEST.
    12·2 answers
  • Please help with my science thank yoouu
    11·1 answer
  • Give two examples of cells that relate their shapes with their functions.<br><br><br>​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!