1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dem82 [27]
3 years ago
5

__________ is a biochemical process used for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thym

ine, in any DNA molecule. By comparing the DNA sequence of two organisms, scientists can see if the organisms are related or not, as well as how closely they are related.
Biology
2 answers:
Bezzdna [24]3 years ago
7 0

Answer:

DNA sequencing

Explanation:

DNA sequencing is the biochemical process that involves discovering the specific arrangements of the bases. The bases are also known as Nucleotides and they are four namely( Adenine, Cytosine, Guanine,Thymine). Every DNA has a specific nucleotide arrangement which makes it unique. This information is important and used by scientists to check for similarities between two or more organisms. It is used in evolutionary research works,crime forensics, paternity and maternity cases

Shkiper50 [21]3 years ago
5 0

Explanation:

DNA sequencing is a biochemical process used for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in any DNA molecule. By comparing the DNA sequence of two organisms, scientists can see if the organisms are related or not, as well as how closely they are related.

You might be interested in
Describe how a measurement can be accurate but not precise?
morpeh [17]
You can have error both human error i.e eye balling a measurement to what looks close. and then you have inherent error the error that is already in the equipment i.e a 2 scales one can give a measurement of x when set to zero and if put it on a second scale you could get a measurement of y when set to zero because of calibration gravity etc things you cant control  
3 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
The somatic cells, or non-reproductive cells, in the human body contain 46 chromosomes that occur as 23 pairs of chromosomes.
harina [27]
A half of the chromosomes are from each parent
5 0
2 years ago
Read 2 more answers
what are the evolutionary evidence of giant pandas and why did they stop eating fish anymore PLEASE WHEN ANSWERING WRITE DOWN TH
maks197457 [2]
Http://blogs.discovermagazine.com/seriouslyscience/2015/01/29/pandas-ancestors-ditch-meat-bamboo/



According to this study, it may have had to do with the deactivation (technically known as “pseudogenization”) of an umami taste receptor gene. Umami is the taste that makes things like meat, soy sauce, and mushrooms extra yummy. Apparently, at some point in panda evolution, the umami receptor became non-functional. Based on how much the gene has changed, the authors calculate that this happened around the same time that pandas started eating bamboo. Whether it’s cause or effect is unclear, although the authors think the switch to bamboo may have happened before the gene was lost. Regardless, the loss of the gene reinforced the panda’s vegetarian diet because it made meat less delicious to the bears.

Sorry it's a lot but hope it's useful
4 0
3 years ago
Which of the following does not show the law of conservation of mass?
EastWind [94]
Is there a photo or something
8 0
3 years ago
Read 2 more answers
Other questions:
  • It would take one light year to travel to the sun. True False
    14·2 answers
  • A cross-country skier who prefers high elevation but flat terrain is looking for a ski vacation destination.
    14·2 answers
  • Please help
    13·1 answer
  • Water is an important biomolecule. o True False​
    15·1 answer
  • What factors dictate the choice of tests included in a combination medium?
    13·1 answer
  • Matching. Each letter may be used once, more than once or not at all.
    7·1 answer
  • Can someone help me with question 1 pls:)
    15·1 answer
  • Which statement describes the process of photosynthesis shown in the equation below
    8·1 answer
  • At Weeks Bay there was a population of 200 alligators. In May of 2006 a new species of catfish was released into the Mississippi
    14·1 answer
  • True or False? Many of the early steps in the reproductive process can be carried out in the laboratory through procedures such
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!