1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
3 years ago
15

Which term best describes a community in which many jobs involve generating ideas and providing services

Biology
2 answers:
MAXImum [283]3 years ago
6 0

Answer:

post - industrial is correct

Explanation:

Dmitry_Shevchenko [17]3 years ago
5 0

The correct answer is: post-industrial community (society).

Post-industrial community is the society in which service sector brings more wealth than the manufacturing sector of the economy. In this kind of society, knowledge is valuated and producing ideas is the main way to grow the economy of that society.


You might be interested in
in humans glucose is kept in balance in the bloodstream by insulin which concept does this best illustrate
Bas_tet [7]

Answer:

Homeostasis

Explanation:

Homeostasis is the maintenance of a steady-state/condition in the body to ensure the optimal workings of the cells. Blood sugar level is one of the variables in the body that also has to be maintained through  positive and negative feedback loops to maintain the desired level. Insulin is the hormone used for negative feedback (to reduce the blood sugar level when it goes higher than the normal level) and Glucagon is the hormone for positive feedback (to raise the blood sugar level when it goes below the normal levels).

7 0
3 years ago
Which of the following has mechanical energy?
andrey2020 [161]

Answer:

stretched band

4 0
4 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Biogeography is the study of the distribution of species in different regions through the history of life on Earth. The map belo
Tcecarenko [31]

<u>Answer</u>: A) Africa and South America only

As shown in the map, the fossil evidence suggests that Cynognathus lived on the modern day continents of South America and Africa. Thus, from this distribution and the fragmentation of the ancient landmass into today's continents, result in the distribution of Cynognathus offspring species also only within the continents of Africa and South America.

7 0
3 years ago
The theory of plate tectonics explains the movement of the plates by convection cells in which of
telo118 [61]
Upper mantle I’m pretty sure !
4 0
3 years ago
Other questions:
  • Why do letters blur when I look at a word search?
    15·1 answer
  • { Please Answer Quickly! 50 Points! }
    9·1 answer
  • Hypothesis: Increasing water temperature had no effect on the fermentation rate of yeast. Experiment: Compared yeast in room-tem
    12·1 answer
  • Which statements describe the Sun? Check all that apply.
    13·1 answer
  • The ________ structure of a protein is created by hydrogen bonds between the hydrogen atom on the amine group and the oxygen ato
    11·1 answer
  • A relationship in which one species consume and the other is killed is known as
    7·1 answer
  • Are living and non living things made of the same ingredients?why or why not?
    14·1 answer
  • What is one of the main functions of the nucleus of an animal cell? It is the place where energy is produced for the animal. It
    14·1 answer
  • Put "Single Trait Genes" in a sentence
    7·2 answers
  • Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as an X-linked recessive allele in humans. A woman whose father
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!