Inadequate dietary vitamin D or its deficiency leads to malabsorption of calcium. Nutritional disorder leads to the rare disease rickets, which causes bones to become soft and bend in children. In adults, vitamin D deficiency leads to osteomalacia, which causes weak bones, bone pain and muscle weakness.
The body needs vitamin D to properly absorb calcium and phosphorus from the diet. However, keeping the right quantities of calcium and phosphorus in bones is challenging when vitamin D levels are low.
The two sources of vitamin D are-
- Natural sunlight
- Foods such as fish oil, Egg yolk and fatty fishes like salmon and mackerel
There are other disease conditions which lead to poor absorption of vitamin D-
- Inflammatory bowel disease
- Celiac diseases
- Kidney problems
To learn more about Rickets here-
brainly.com/question/26292489
#SPJ4
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
<span>Steroids are like hormones that greatly influences bodily activities mostly in growth and function. These functions may modify, change and control one’s body organs or system that’ll vary in form, shape or structure due to these hormone-like compounds and also, it can affect one’s psychological and neurological state. There are several types of steroids. Examples can include: </span><span><span>
1. </span>Sex steroids. These are can influence reproduction and sex characteristics.</span> <span><span>
2. </span>Anabolic steroids. Most abused in many athletic activities. These steroids are used for muscle and bone growth.<span>
</span></span>
A. Carbon
It's carbon because it is in all plants and fossil fuels. Hope this helps and is correct.
