1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Varvara68 [4.7K]
3 years ago
12

Which two protists have eyespots

Biology
1 answer:
Ne4ueva [31]3 years ago
6 0
I think it’s euglena and volvox
You might be interested in
Which group of organisms is most likely relate to archeabacteria
olasank [31]
Protista organisms are most closely related to Archaebacteria.
7 0
3 years ago
Compare what ways are planets and<br> dwarf planets similar.
Cerrena [4.2K]
So the similarity of the planets and the dwarf planets are they are both mostly round because they have sufficient gravity to flatten their own surfaces into a sphere. The differences are that planets are big enough to clear the whole region of space where they orbit the sun whereas dwarf planets do not.
3 0
3 years ago
Are crocodiles adorable? Show me pictures for proof
Lubov Fominskaja [6]

Answer: They are as adorable as any animal could be.

4 0
3 years ago
Read 2 more answers
Why are the farmers and scientists in this area choosing to use owls instead of pesticides
SVEN [57.7K]
Probably to not contaminate food or accidentally poison it.
5 0
3 years ago
Read 2 more answers
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
3 years ago
Other questions:
  • Which disruption in the water cycle would most likely affect photosynthesis?
    13·2 answers
  • After observing the F2 generation, what conclusion did Mendel come to?
    8·2 answers
  • What are 3 nonliving things in the environment?
    5·2 answers
  • Special organs that store leukocytes are the _____. thymus and spleen thymus and hypothalamus spleen and liver pancreas and pitu
    9·1 answer
  • How does artificial selection supports Darwin's hypothesis ​
    10·2 answers
  • Detritus based foodwebs, rather than consumer based foodwebs, dominate the energetics of most ecosystems.
    12·2 answers
  • The woolly mammoth lived during the Ice Age. Why did it become extinct? A) disease B) pollution C) over-hunting D) habitat chang
    11·1 answer
  • Use the picture to summarize the difference between the daughter cells that result from mitosis and meiosis.
    14·1 answer
  • In which phylum do organs and organ systems first appear?
    9·2 answers
  • How does photosynthesis allow plants to form dna
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!