1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flura [38]
2 years ago
6

Part D What is the direction of ice movement at the Roche Moutonnée placemark? View Available Hint(s) What is the direction of i

ce movement at the Roche Moutonnée placemark? west to east north to south lower to higher elevation south to north east to west
Geography
1 answer:
Hunter-Best [27]2 years ago
8 0

Answer: East to West

Explanation:

A Roche Moutonnée is a rocky mass formed by abrasion when a glacier passes over a bedrock. The glacier moves from the east to the west, creating different slopes on each side of the Roche Moutonnée. this is due to different processes o each side. When the glacier travels up the bedrock, it smoothens the edges, creating rounded tips. On the downward journey, melted ice from the glacier leaks into the rocks. On refreezing, the ice creates cracks in the rock and breaks away parts of the rock.

You might be interested in
Giải pháp biến đổi khí hậu ở đồng bằng sông cửu long
Advocard [28]

Answer:

b

Explanation:

4 0
2 years ago
The primary export of the Arabian Peninsula is gold.<br> true or false
enot [183]
Answer: FALSE.


Explanation:
The primary export of the Arabian Peninsula is oil. Saudi Arabia is the world´s larger exporter of oil
5 0
2 years ago
Read 2 more answers
What is found at 0º latitude?
bagirrra123 [75]

Answer:

The Equator

Explanation:

The Equator is found at 0° latitude. 0° latitude divides the Earth into two equal hemispheres known as the north and south hemispheres.

4 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
2 years ago
Ocean water is most saline where rivers empty into the ocean. in dense seawater. near coastal areas with high rainfall. in icebe
Maru [420]
Im pretty sure its the second one. In dense seawater
4 0
3 years ago
Read 2 more answers
Other questions:
  • Tokyo is one of the world’s foremost global cities. Read about Tokyo’s culture and history, and identify three ways that Tokyo f
    14·2 answers
  • This volcano is composed of different types of lava flows and ash deposits, has steep slopes on its sides, and is typically seve
    15·1 answer
  • What are the three major states of North America?
    5·2 answers
  • Engineers and physicists dream of solving the world's energy supply problem by constructing power plants that would convert hydr
    12·1 answer
  • Which of the following is considered sacred the people of Switzerland
    15·1 answer
  • Help plzzz. Use the Internet or the newspaper to find a current instance of conflict or cooperation. Explain the role that cultu
    15·1 answer
  • The satellite photo above shows a narrow strip of land that connects two larger landmasses. Which type of landform is shown in t
    6·2 answers
  • The World Wars of the twentieth century immediately led to __________.
    13·1 answer
  • Which of the following benefits african consumers but not african farmers?
    6·2 answers
  • What aspect of the Amazon rain forest has the potential to help the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!