1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
7

The Calvin cycle happens in the ___________ of the chloroplast.

Biology
1 answer:
zhannawk [14.2K]3 years ago
4 0
Light Independent Reaction:)
You might be interested in
What is the mass of all the worker bees in the hive together? Write your answer in scientific notation.
Lisa [10]

Answer:

4 × 10^0 kg or 4×E0 kg.

Explanation:

Before delving into or solving the Calculation, let us check one or two things about worker bees.

WHAT IS A WORKER BEE?.

Bees generally are social insects living in an organized community and they consist of three castes which include; the drone bees, worker bees, and the queen bees.

The queen bees are the female bees while the drone bees are the male bees.

The WORKER BEES are female bees too, but the only difference between them and the queen bees is that they (worker bees) do not reproduce like the queen bees. They are saddled with the responsibility of looking for food and maintaining the hive temperature.

Now to the question, the mass of a bee= 1 × 10^-4 kg. And there are 4 × 10^4 bees in hive. Therefore, the mass of all the worker bees in the hive together = (1 × 10^-4) × (4×10^4).

==> 4 × 10^0 kg, or 4E0 kg.

8 0
3 years ago
Areas near oceans or large lakes tend to have more moderate climates than do areas far from large bodies of water. Which of thes
Damm [24]

Answer:

B

Explanation: The specific heat of any particular substance is usually defined as the amount of heat energy that is required to raise a unit mass of the material by 1°C. The water has this high heat capacity as a result of which the water bodies such as oceans, seas, and lakes tend to become hot and cold at a much slower rate.

This is the third question of yours I've answered

3 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
100POINTS &amp; BRAINLIEST IF YOU ANSWER CORRECTLY!!
Delicious77 [7]

Answer:how much alligators are we talking about

Explanation:

3 0
2 years ago
Read 2 more answers
What two body systems work together in combination in order for ambulation to accure
REY [17]
Skeletal and Muscular Systems
7 0
3 years ago
Other questions:
  • 1) The density of a substance is the ratio of its mass to its volume. The formula for density is: D = mass/volume. If the densit
    6·1 answer
  • Genetics experiments on the breeding of plants or animals are based in the laws of _____
    5·1 answer
  • our study partner has drawn four models of membrane-bound vesicles to try to show what a vesicle would look like with water both
    13·1 answer
  • Which is the central element for all living things?
    7·1 answer
  • Fossils help us reconstruct plant and animal life in the past as well as their evolutionary processes, which can be either slow
    7·1 answer
  • Can someone help me with the question please.
    14·1 answer
  • Explain in at least five sentences what you've learned about how
    8·2 answers
  • How does an inhaler work?
    14·1 answer
  • Honey bees often make homes in the hollow knots of trees. The tree is unaffected by this relationship while the
    12·1 answer
  • Environmental factors typically activate genes in a cell by causing the cell to --
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!