1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
3 years ago
9

George and Javier each want to buy a bicycle.  George has already saved $35 and plans to save $10 per week.  Javier has $26 and

plans to save $13 per week.
a)  Write a system of equations to represent the total amount saved (y) after (x) weeks.
Mathematics
1 answer:
Gre4nikov [31]3 years ago
8 0

Answer:

y=35 + 10x

y= 26+ 13x

Step-by-step explanation:


You might be interested in
the scale on a map se oanchows 5 centimeters equals 2 kilometers what nuumber of centimeters on the map represents an actual dis
Igoryamba
12.5 cm equals 5 km.
8 0
3 years ago
What is the measurement of a flat angle
vladimir2022 [97]
Answer is:
180 degrees
7 0
3 years ago
I posted a question similar to this but I entered it wrong too many times :(
slava [35]

Answer:

\sqrt[4]{\frac{5}{7} }

Step-by-step explanation:

^4√5/^4√7

~Apply radical rules

^4√5/7

Best of Luck!

5 0
3 years ago
Read 2 more answers
Help please, I have all the work I just don't understand part B
ollegr [7]
Answer is b the answer is because there is no C or D in my conversations are in my store
4 0
3 years ago
What is the theoretical probability, as a percent, of flipping heads?
Rufina [12.5K]
I would say 50/50 chance because it can go ether ways one can go heads the others can go tails
5 0
3 years ago
Other questions:
  • Y=log x If y=10, then what is x?
    10·1 answer
  • There are 5people trying for 3openings how many possible outcomes are there ​
    7·1 answer
  • three tanks are capable of holding 108 168l and 180 litre of milk determine the capacity of the greatest resource which can be u
    14·1 answer
  • What is the oblique asymptote of the function f(x) = the quantity x squared minus 5x plus 6 over the quantity x minus 4?
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How many pizzas does a restaurant make each night if 25% of the total is equal to 90 pizzas?
    12·2 answers
  • Mrs. Palma took her coworkers out to dinner yesterday and their subtotal was $72.39
    11·1 answer
  • Meh idc whats up fook whatcha nee
    9·2 answers
  • Suppose that an individual has a body fat percentage of 15.6% and weighs 156 pounds. How many pounds of his weight is
    11·1 answer
  • I need help, if its easy to answer shame on me lol
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!