1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
15

Help d f f dff f kl k

Biology
2 answers:
Readme [11.4K]3 years ago
8 0
I think it’s B (hope this helps)
marissa [1.9K]3 years ago
4 0

Answer:

B

Explanation:

just do it

You might be interested in
-. In which phylum does a coelom first appear?
adoni [48]

Answer:

The answer is a. Annelida

8 0
3 years ago
The four-field system allows for question 46 options:
finlep [7]
B
less field space will be wasted
8 0
3 years ago
6. Photosynthesis uses energy of sunlight to convert water and carbon
Blababa [14]

Answer:

d

Explanation:

sugars are also known as glucose and the formula for photosynthesis is water+carbon dioxide=oxygen+glucose

3 0
3 years ago
The article asserts that carbon monoxide is likely the most harmful pollutant in car exhaust. Why is it so harmful? What necessa
zhuklara [117]
Answer:
Step by step explanation
4 0
3 years ago
What is turgor pressure, what causes it, and what does it do for a plant?
ANEK [815]

Turner pressure is simply the force within the plant cell that pushes the cell membrane or plasma membrane against the cell wall.

It is caused by the Osmotic flow of water through the semi permeable membrane.

It helps the plant cells to remain turgid and stand tall so as to prevent it from wilting

4 0
4 years ago
Read 2 more answers
Other questions:
  • In the fruit fly Drosophila melanogaster, the recessive allele (p), when homozygous, determines pink eyes. Pp or PP results in w
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • A microscope reveals one hundred similar cells arranged end to end in a space of 1 milimeter
    5·1 answer
  • If a gene has one completely dominant allele and one recessive allele, how
    5·1 answer
  • Molecular biology of the cell​
    9·1 answer
  • What are the main structures and functions of the musculoskeletal system? What are the main structures and functions of the inte
    11·2 answers
  • In a population of wild bees, a mutation resulted in slightly larger wingspan in some of the bees. This larger wingspan made the
    11·1 answer
  • In which areas are earthquakes more likely to occur? Select one: O Polar regions O Island shorelines. O Within 10 miles of activ
    14·2 answers
  • ]
    14·1 answer
  • Streptomycin is an antibiotic that interferes with the function of the 30s subunit of the prokaryotic ribosome. what is the cons
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!