1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mnenie [13.5K]
4 years ago
10

What are the raw materials of water?

Biology
2 answers:
LuckyWell [14K]4 years ago
6 0
There are different materials of raw water, but also the raw water comes from ponds,rivers, and oceans but they might be good sometimes, and gas not been treated and has bacteria or mold buy that is not good.
lisabon 2012 [21]4 years ago
3 0
A water molecule consist of 2 atoms of hydrogen bonded to 1 atom of oxygen. The chemical symbol is H2O
You might be interested in
Which answer choice best describes the difference between folded mountains and fault-block mountains?
Vikki [24]
The correct answer is B
8 0
4 years ago
Read 2 more answers
Photosynthesis provide food and oxygen to all the living organism Is this true or False ???​
Arisa [49]

Answer:

True

I hope this helps!

3 0
3 years ago
Read 2 more answers
According to the pie chart, which two orders of mammals make up more than half of the biodiversity for class mammalia?
Masja [62]

Answer:

ur answer is A

Explanation:

just took the test good luck :)

3 0
3 years ago
How many months of a year do most conifers have green leaves?
gogolik [260]
The answer to your question is12
8 0
4 years ago
Read 2 more answers
When a new strain of virus is discovered, what must scientist first do to prevent the spread
sergij07 [2.7K]

-identify the symptoms that people develop due to the strain

-work on an effective vaccine to help prevent the spread of the virus

8 0
3 years ago
Other questions:
  • 1. Biotic factors like wolves can have an effect on abiotic factors like rivers.
    11·1 answer
  • Which is a product of the Krebs cycle<br><br> A. ADP<br> B. NADH<br> C. pyruvate<br> D. glucose
    10·1 answer
  • Specialized lymphatic capillaries called lacteals are _________.a. more numerous than blood capillaries. b. necessary for the tr
    6·1 answer
  • Worth 30 points! Which cell part provides a similar function in a plant cell?
    5·2 answers
  • Which of the following is a tentative answer to a question?
    11·1 answer
  • Which makes viral infections difficult to defend?
    12·1 answer
  • In which taxonomic levels will u find both the ringtail and the human
    8·1 answer
  • Gary is examining an organism. Which of the following characteristics would indicate that the organism belongs in the kingdom An
    12·1 answer
  • A trait that can mask another trait is known as a
    14·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!